Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • FuzzyCoder
    Member
    • Aug 2011
    • 13

    #1

    GSNAP Output

    I have been able to run GSNAP on a 8GB, 8 cpu machine using the following command (executed from the GSNAP bin directory):

    Code:
    ./gsnap --format=sam --read-group-id=30D --batch=4 --nthreads=8 --read-group-name=Condition1 --input-buffer-size=5000 --max-mismatches=4 --kmer=15 --dir=/home/myPath/gsnap/gmapdb/mm9 --db=mm9 --novelsplicing=1 -s mm9.splicesites.iit /home/myPath/gsnap/30D_217_12WKS_R1.fastq /home/myPath/gsnap/30D_217_12WKS_R2.fastq
    As it ran, it streamed what appeared to be output of aligned/mapped and annotated reads.

    However, I am unable to find any output file (SAM or otherwise) generated by the process. The process appeared to end without error, reporting the reads/sec performance of GSNAP.

    What do I need to do to either find the output file (already searched for *.sam, and *.* within past day, everywhere), or specify where the output should be written?
    Best Regards,

    Paul Bergmann
  • schelhorn
    Member
    • Sep 2010
    • 10

    #2
    Umm, I might be wrong since I have't run your configuration, but shouldn't redirecting the stdout output into a file be all you need? SAM is a line-based ASCII format, probably that's exactly the running output you're seeing. If that is the case just append
    Code:
    > mysamfile.sam
    at the end of the command and you should be good. Btw, having a bioinformatician in the department helps, too

    Comment

    • twu
      Developer of GMAP and GSNAP
      • Oct 2011
      • 17

      #3
      Hi,

      I am the developer of GSNAP. The program as you have run it will send the output to stdout (which is the stream of alignments you saw). You should therefore send the output into a file, as suggested above, using the "> outputfile" convention for Unix.

      Alternatively, there is a flag called --split-output that will send output to individual files, according to how they aligned (i.e., concordant unique, halfmapping multiple, and so on).

      Regards,

      Thomas Wu

      Comment

      • gpcr
        Member
        • May 2010
        • 18

        #4
        gsnap runn error?

        Can any one solve this error:

        Code:
        gsnap --split-output bcsf -A sam -B 4 -t 8 -k 15 --read-group-id=SN388 --read-group-name=bcsf --input-buffer-size=3000 -D /data/gmap/hg19 -d hg19 -N 1 -s /data/gmap/hg19/hg19.maps/hg19.refGene.splicesitesfile.iit /seq/L005.ft.R1_1.fastq /seq/L005.ft.R2_2.fastq
        Error message:

        Novel splicing (-N) and known splicing (-s) both turned on => assume reads are RNA-Seq
        Allocating memory for compressed genome...done (1,160,885,244 bytes, 1.79 sec)
        Looking for index files in directory /data/gmap/hg19
        Gammaptrs file is hg19.ref12153gammaptrs
        Offsetscomp file is hg19.ref12153offsetscomp
        Positions file is hg19.ref12153positions
        Allocating memory for ref gammaptrs, kmer 15, interval 3...done (67,108,868 bytes, 0.11 sec)
        Allocating memory for ref offsets, kmer 15, interval 3...done (349,277,996 bytes, 0.53 sec)
        Allocating memory for ref positions, kmer 15, interval 3...done (3,815,118,780 bytes, 5.79 sec)
        Reading splicing file /data/gmap/hg19/hg19.maps/hg19.refGene.splicesitesfile.iit locally...found donor and acceptor tags, so treating as splicesites file
        splice distances present...390347 unique splicesites...390347 valid splicesites...splicetrie_obs has 644549 entries...splicetrie_max has 48518627 entries...done
        GMAP modes: pairsearch, terminal, improvement
        Starting alignment
        Illegal instruction

        Comment

        • twu
          Developer of GMAP and GSNAP
          • Oct 2011
          • 17

          #5
          Illegal instruction in GSNAP

          The illegal instruction error is occurring because the environment where you built GSNAP is different from the environment where you are running it. When you build GSNAP, the configure command sees if it can compile and run the program with the flag "-mpopcnt", which uses a machine-level instruction to count the number of bits in a word and results in a minor increase in speed. However, if you build on a machine where -mpopcnt works and then you move the program to a machine where the built-in popcount instruction does not exist, the machine will complain about an illegal instruction.

          The solution is to rebuild GSNAP, this time running configure with the flag --disable-popcnt, which will not compile the programs with the "-mpopcnt" flag, even if it works in your build environment.

          If you have any further questions or problems, please feel free to send email directly to me at [email protected].

          Regards,

          Thomas Wu

          Comment

          • gpcr
            Member
            • May 2010
            • 18

            #6
            @Twu; I recompiled gmap in the current computer its working fine so far...Thanks!!!

            Comment

            • ParthavJailwala
              Member
              • Oct 2009
              • 27

              #7
              Hi Thomas (@twu),

              We have been trying to use GSNAP for alignment, followed by cufflinks for downstream analysis on RNA-seq data. When we look at the SAM file produced by GSNAP (alignment done with splicing on), the 'XS:A: ' tag should have either 'XS:A:+' or 'XS:A:-' to represent strand information for splicing reads; however, we also notice numerous alignment entries to have an 'XS:A:?'. These entries are not recognized by cufflinks as it expects either a '+' or a '-' in the XS:A tag. Any clues on what we should do to make the SAM file compatible with cufflinks? Thanks

              Comment

              • gpcr
                Member
                • May 2010
                • 18

                #8
                I think new version might have rectified 'XS:A:?'.
                check here for the updated version

                "Eliminated reporting of XS:A:? in cases of long deletions being considered incorrectly as introns "

                Comment

                • ParthavJailwala
                  Member
                  • Oct 2009
                  • 27

                  #9
                  @gpcr,
                  Thanks for that pointer....it turns out we had the path to the older version in the .bash_profile.
                  We will run GSNAP using the latest version to see if the XS tag errors are resolved.

                  Thanks

                  Comment

                  • twu
                    Developer of GMAP and GSNAP
                    • Oct 2011
                    • 17

                    #10
                    Also, I am about to release a new version later today (version 2012-03-20). I believe this new version should completely eliminate all occurrences of "XS:A:?".

                    Comment

                    • ParthavJailwala
                      Member
                      • Oct 2009
                      • 27

                      #11
                      Originally posted by twu View Post
                      Also, I am about to release a new version later today (version 2012-03-20). I believe this new version should completely eliminate all occurrences of "XS:A:?".
                      Hi Thomas,

                      Thanks for your response. I checked the GSNAP webpage, and yes, there is a new version indeed (2012-03-20). We will use this version and see if the 'XS:A:?' related errors are resolved.

                      Thanks

                      Comment

                      • ParthavJailwala
                        Member
                        • Oct 2009
                        • 27

                        #12
                        Parse error in SAM file from GSNAP

                        I used the latest version of GSNAP with default flags to produce a SAM file. When trying to convert SAM to BAM for input to cufflinks, I get this error:

                        'Parse error in line 19446415: missing colon in auxiliary data'
                        Aborted

                        Then, when I look at the read at that line number, I get this:
                        >$sed -n 19446415p MC01.sam

                        HTML Code:
                        3PO5HQ1:154:D0FV2ACXX:2:1104:9525:98311	387	15	82664506	1	100M1S	=	82664506	0	CTTAGATCTTATTCATCAGCCTGCTGAACAGTTCCTTTTTCAGAGACATAGATACCATCCAAAAATTTCCTGATATCCTTGTTTTTAACTGTTGTGGCTTT	CCCFFFFFHHHHHJJJJJJJJJJJJJJIJJJIIIJJJJJJIJIIJJJJJJJJJJJJJIJIJJIGIJJJHIJJJJJJEHIHHHHHHFFFFFEEEEEDDDDD3MD:Z:100	NH:i:4	HI:i:3	NM:i:0	SM:i:1	XQ:i:40	X2:i:40
                        What is wrong with this read entry in the SAM file that is throwing the error above?

                        Thanks
                        Last edited by ParthavJailwala; 03-22-2012, 11:38 AM.

                        Comment

                        • ppoudel
                          Junior Member
                          • Feb 2012
                          • 5

                          #13
                          hi,

                          what does -n and -Q option mean in GSNAP, does -n mean the number of places that a read maps to a genome? I would like to write only the uniquely mapped reads to the output file.

                          Comment

                          • ParthavJailwala
                            Member
                            • Oct 2009
                            • 27

                            #14
                            Originally posted by ppoudel View Post
                            hi,

                            what does -n and -Q option mean in GSNAP, does -n mean the number of places that a read maps to a genome? I would like to write only the uniquely mapped reads to the output file.
                            Hi ppoudel,

                            As per the GSNAP README, there is a -n flag that the user can specify for the number of hits that GSNAP should show. I did not find the -Q option, but I guess you imply the "--quiet-if-excessive" which is linked to the -n option, as per this paragraph from the README:
                            Hope that helps.

                            Thanks
                            Parthav

                            ------------------------------------------------------------------------------------
                            After the query line, each of the genomic hits is shown, up to the
                            '-n' parameter. If too many hits were found (more than the '-n'
                            parameter), the behavior depends on whether the "--quiet-if-excessive"
                            flag is given to GSNAP. If not, then the first n hits will be printed
                            and the rest will not be printed. If the "--quiet-if-excessive" flag
                            is given to GSNAP, then no hits will be printed if the number exceeds
                            n.

                            Each of the genomic hits contains one or more alignment segments,
                            which is a region of continuous one-to-one correspondence (matches or
                            mismatches) between the query and the genome. Multiple segments occur
                            when the alignment contains an insertion, deletion, or splice. The
                            first segment is marked by a space (" ") at the beginning of the line,
                            while the second and following segments are marked by a comma (",") at
                            the beginning of the line. (In the current implementation of GSNAP
                            that allows only a single indel or splice, the number of segments is
                            at most two.)
                            ---------------------------------------------------------------------

                            Comment

                            • ParthavJailwala
                              Member
                              • Oct 2009
                              • 27

                              #15
                              Re: GSNAP output

                              Originally posted by ppoudel View Post
                              hi,

                              what does -n and -Q option mean in GSNAP, does -n mean the number of places that a read maps to a genome? I would like to write only the uniquely mapped reads to the output file.
                              Hi ppoudel,

                              As per the GSNAP README, there is a -n flag that the user can specify for the number of hits that GSNAP should show. I did not find the -Q option, but I guess you imply the "--quiet-if-excessive" which is linked to the -n option, as per this paragraph from the README:
                              Hope that helps.

                              Thanks
                              Parthav

                              ------------------------------------------------------------------------------------
                              After the query line, each of the genomic hits is shown, up to the
                              '-n' parameter. If too many hits were found (more than the '-n'
                              parameter), the behavior depends on whether the "--quiet-if-excessive"
                              flag is given to GSNAP. If not, then the first n hits will be printed
                              and the rest will not be printed. If the "--quiet-if-excessive" flag
                              is given to GSNAP, then no hits will be printed if the number exceeds
                              n.

                              Each of the genomic hits contains one or more alignment segments,
                              which is a region of continuous one-to-one correspondence (matches or
                              mismatches) between the query and the genome. Multiple segments occur
                              when the alignment contains an insertion, deletion, or splice. The
                              first segment is marked by a space (" ") at the beginning of the line,
                              while the second and following segments are marked by a comma (",") at
                              the beginning of the line. (In the current implementation of GSNAP
                              that allows only a single indel or splice, the number of segments is
                              at most two.)
                              ---------------------------------------------------------------------

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM
                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 08-03-2026, 10:13 AM
                              0 responses
                              21 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-31-2026, 02:55 AM
                              0 responses
                              35 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-24-2026, 12:17 PM
                              0 responses
                              25 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-23-2026, 11:41 AM
                              0 responses
                              21 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...