Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Small RNA sequencing on Illumina

    2 questions. What are people using to isolate total RNA for the small RNA prep and has anyone found a way to multiplex small RNA samples?

  • #2
    Hello,
    We will prepare miRNA-Seq library and send it out for sequencing on a GAII. Can anyone confirm that these adapter/Primer sequences first reported by ECO have (can) been used successfully on the GAII (and presumably GAIIx)?

    Small RNA oligonucleotide sequences
    RT Primer
    5' CAAGCAGAAGACGGCATACGA

    5' RNA Adapter
    5' GUUCAGAGUUCUACAGUCCGACGAUC

    3' RNA Adapter
    5' P-UCGUAUGCCGUCUUCUGCUUGUidT

    Small RNA PCR Primer 1
    5' CAAGCAGAAGACGGCATACGA

    Small RNA PCR Primer 2
    5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

    Small RNA Sequencing Primer
    5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

    Was (is) there a GAI instrument? Does it require different Adapter/Primer sequences? Can't find any evidence of a GAI version on Illumina website.
    Thanks in advance

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Recent Advances in Sequencing Analysis Tools
      by seqadmin


      The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
      05-06-2024, 07:48 AM
    • seqadmin
      Essential Discoveries and Tools in Epitranscriptomics
      by seqadmin




      The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
      04-22-2024, 07:01 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 05-14-2024, 07:03 AM
    0 responses
    20 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 05-10-2024, 06:35 AM
    0 responses
    44 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 05-09-2024, 02:46 PM
    0 responses
    54 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 05-07-2024, 06:57 AM
    0 responses
    42 views
    0 likes
    Last Post seqadmin  
    Working...
    X