Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • na_sd
    Junior Member
    • Nov 2015
    • 3

    miRNA-Seq files header and expression values

    I have downloaded miRNA seq file from GSE31617
    Files contain information like following:

    hsa-let-7a-1 hsa-let-7a t0000020 25073 37013 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
    hsa-let-7a-1 hsa-let-7a* t0059321 6 12 3p CTATACAATCTACTGTCTTTC CTATACAATCTACTGTCTTTC S
    hsa-let-7a-2 hsa-let-7a t0000020 25073 37025 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
    hsa-let-7a-2 hsa-let-7a-2* t1103419 1 1 3p CTGTACAGCCTCCTAGCTTTCC CTGTACAGCCTCCTAGCTTTCC S
    hsa-let-7a-3 hsa-let-7a t0000020 25073 37128 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
    hsa-let-7a-3 hsa-let-7a* t0059321 6 12 3p CTATACAATCTACTGTCTTTC CTATACAATCTACTGTCTTTC S
    hsa-let-7b hsa-let-7b t0000335 3748 7938 5p TGAGGTAGTAGGTTGTGTGGTT TGAGGTAGTAGGTTGTGTGGTT S
    hsa-let-7b hsa-let-7b* t0163422 2 2 3p CTATACAACCTACTGCCTTCC CTATACAACCTACTGCCTTCCC D
    hsa-let-7c hsa-let-7c t0000721 2095 3068 5p TGAGGTAGTAGGTTGTATGGTT TGAGGTAGTAGGTTGTATGGTT S
    hsa-let-7d hsa-let-7d* t0056459 6 18 3p CTATACGACCTGCTGCCTTTC CTATACGACCTGCTGCCTTTCT D
    hsa-let-7d hsa-let-7d t0004262 320 767 5p AGAGGTAGTAGGTTGCATAGTT AGAGGTAGTAGGTTGCATAGTT S


    First, I wanna know what is the header of columns? (files do not have any header line)
    Second, I would like to calculate expression values for miRNAs, how can I do it?
    Thanks

    PS. I am new in miRNAseq files.
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    For ref Cross-posted: https://www.biostars.org/p/165320/

    I am thinking that it is some sort of alignment format but the exact name is eluding me (and my google-fu for now). Hopefully some one else will be able to recollect.

    Where exactly did you get that data file from on SRA?
    Last edited by GenoMax; 11-11-2015, 09:21 AM.

    Comment

    Latest Articles

    Collapse

    • mylaser
      Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by mylaser
      Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
      If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
      This guide explains everything you need to know about...
      Today, 01:13 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    10 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-07-2026, 11:05 AM
    0 responses
    22 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-02-2026, 11:08 AM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Working...