GSNAP error Problem Sequence

[Marcha]

Hi everybody,

For my RNA-seq analysis, I wanted to use GSNAP to align my reads.
Building the index ran without any problems, but when I actually start mapping my reads I get first get Signal received: SIGSEGV
Calling Access_emergency_cleanup, and thereafter "Problem sequence" after which the program stops.

This is the command I used:
gsnapl --nthreads 6 -d gsnap_GRCh38_apr2019 -D ${GENOMEDIR} ${READ1}${SUFFIX2} ${READ2}${SUFFIX2} -A sam --output-file ${align_DIR_GSNAP}${READ1:${#SOURCEDIR}:-${#SUFFIX1}-${#PAIR1}}_GSNAP.sam -N 1

This is what is printed in the terminal:
[ALIGNING] GSNAP : [APA_The_000_2]
GSNAP version 2019-06-10 called with args: gsnapl.avx2 --nthreads 6 -d gsnap_GRCh38_apr2019 -D /share/tools/data/genomes/GRCh38_r96_april2019/ /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/APA_The_000_2_R1.fastq /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/APA_The_000_2_R2.fastq -A sam --output-file /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/GSNAP/APA__GSNAP.sam -N 1
Novel splicing (-N) turned on => assume reads are RNA-Seq
Checking compiler assumptions for SSE2: 6B8B4567 327B23C6 xor=59F066A1
Checking compiler assumptions for SSE4.1: -103 -58 max=198 => compiler zero extends
Checking compiler assumptions for SSE4.2 options: 6B8B4567 __builtin_clz=1 __builtin_ctz=0 _mm_popcnt_u32=17 __builtin_popcount=17
Finished checking compiler assumptions
Allocating memory for compressed genome (oligos)...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.genomecomp...done (21,344,119,460 bytes, 13.84 sec)
Allocating memory for compressed genome (bits)...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.genomebits128...done (21,344,119,488 bytes, 48.13 sec)
Looking for index files in directory /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019
Pointers file is gsnap_GRCh38_apr2019.ref153offsets64meta
Offsets file is gsnap_GRCh38_apr2019.ref153offsets64strm
Positions files are gsnap_GRCh38_apr2019.ref153positionsh and gsnap_GRCh38_apr2019.ref153positions
Offsets compression type: bitpack64
Allocating memory for ref offset pointers, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153offsets64meta...done (134,217,744 bytes, 0.13 sec)
Allocating memory for ref offsets, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153offsets64strm...done (481,344,896 bytes, 0.36 sec)
Allocating memory for ref positions, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153positionsh...done (1,029,358,013 bytes, 2.49 sec)
Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153positions...done (4,117,432,052 bytes, 9.28 sec)
Looking for local files in directory /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019
Table file is gsnap_GRCh38_apr2019.ref081loctable
Pointers file is gsnap_GRCh38_apr2019.ref081locoffsets64meta
Offsets file is gsnap_GRCh38_apr2019.ref081locoffsets64strm
Positions file is gsnap_GRCh38_apr2019.ref081locpositions
Allocating memory for ref offset pointers, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locoffsets64meta...done (3,557,355,520 bytes, 3.70 sec)
Allocating memory for ref offsets, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locoffsets64strm...done (1,828,434,688 bytes, 4.19 sec)
Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081loctable...done (6,947,968 bytes, 0.02 sec)
Allocating memory for ref positions, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locpositions...done (6,176,172,160 bytes, 14.58 sec)
Starting alignment. Writing results to /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/GSNAP/APA__GSNAP.sam
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Removed existing memory for shmid 347209834
Removed existing memory for shmid 346980450
Removed existing memory for shmid 346947667
Removed existing memory for shmid 347013219
Removed existing memory for shmid 347177065

You may want to run 'ipcs -m' to see if any shared memory segments are still in use
You can remove a shared memory segment manually by doing 'ipcrm -m <shmid>'

Problem sequence: HWI-ST1172:242:CBVAFACXX:1:1101:6590:2214 (100 bp)
>HWI-ST1172:242:CBVAFACXX:1:1101:6590:2214
TTGAACGTTCCATGAGCAGCGAGGTGAACCCAGAACCAGTTCCCCCACCAAAGCTGTGGAAAACCAAGAAGCCCTGGAGACCCGTGCACTGGTCGGCCAG
AGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAACTTATCACAGG


Does anyone know what is exactly the problem here and how to fix this?
Thanks already,
Marcha

[emortiz]

I realize almost a year passed since this question was asked. I had the same error recently, so after a lot of troubleshooting I found the cause. I had indexed my reference specifying some of the chromosomes as circular and that was causing this particular error, not on every sample though, but very annoying. Once I re-indexed the genome without marking any chromosome as circular the mapping worked without errors.