Odd sequences in RNAseq fastq

[Kujin Kwon]

Hi all,

Recently, I just ran iSeq for pair ended RNA sequencing and it gave me odd fastq results
Some of Read1(i7) sequences have Adapter sequences with poly G at the end.

@FS10000436:35:BPC29621-1807:1:1101:10010:1370 1:N:0:1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF::FFFFFFFF:FFFFFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

However paired Read2(i5) sequences gave me random and poor quality sequences
@FS10000436:35:BPC29621-1807:1:1101:10010:1370 2:N:0:1
GGGGGGGGGAATTTTTTTTTTTTAAAAAATATTTTTTTTTCTTTTTTTTTTTTTTTTTTCCCTTTTTTTTTTTATATTTTTTTTTTTTTTTTTATATTTTT
+
F:,,,,,,,,,,,F,,:,:FFF,,,::FF,,,,FFF,,,,,:,FFF::FF::,F::F,,,,,,,F,FF::::,,,,,,::F:FFFFFFF,F,,,,,,,,,:

I guess this problem came from library length which is shorter than sequencing length. However, I can't understand why Read2 sequence doesn't show matched short sequences (like adapter with G sequences) but random sequences. Is it cluster problems by short sequences?

Thanks in advance.

[cmbetts]

I take it these are NextSeq or NovaSeq?

This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no signal = G in 2 color chemistry

[GenoMax]

OP says these are from iSeq.

[cmbetts]

Whoops. Same conclusion though. Gs are still the dark channel in the iSeq chemistry

[Kujin Kwon]

Thanks for the answer @cmbetts

no template = no signal = G in 2 color chemistry

Then, random sequence in read2 is also signal of no template?