Illumina Multiplexing Primer 2.0

[eab]

A collaborator has prepared a custom library for our sequencing by amplifying with the following primers.

Multiplexing PCR Primer 1.0:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

Multiplexing PCR Primer 2.0:
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

I told them the library was not yet ready to sequence because Multiplexing PCR Primer 2.0 does not have a flowcell sequence (which it definitely doesn't). Am I correct that the library is not yet ready to sequence?

I recognize the primer's name as belonging to an older version of the Illumina-supplied oligo scheme, but am not sure of how the final library was created in that scheme.

Can someone who used the older scheme let us know if I know what I'm talking about?

Thank you!

[kwaraska]

In the older scheme there was a third indexed primer if I recall.

Illumina has a primer document that includes even back that far. I would post it here, but they do not want us to post it and they take it down.

You can ask Illumina for it directly-it is called the "Illumina Customer Sequence Letter" In it are all the sequences-old and new-along with their copyright information. I'm pretty sure that is why they won't post it here. You are agreeing to the copyright by receiving it from them.