No amplification with Nextera tailed primers

[AngelaT]

Hi all,

We are trying to amplify arbuscular mycorrhizal fungal DNA using the primers NS31/AML2. We got good amplification when using the untailed version of the primers. We then ordered the same primer sequence with Nextera tails added on. When we repeated the PCR reaction, we got zero amplification.

We ran some PCR reactions combining the tailed and untailed primers, and figured out that the problem is happening with the reverse nextera tailed primer, AML2_Nex.

We have already ordered new primers and troubleshooted with IDT, ran gradient PCRs, and are going to try a high fidelity polymerase next.

I'd love to know if anyone else has had a similar issue and can give any ideas for what's going on. In theory, the nextera tails should not be causing issues and since the untailed version worked so well, we're not sure where to look next.

I will add that at first the sequences we submitted to IDT had the nextera tail at the wrong end of the primer sequence. We re-ordered the primers and they've assured us the sequence is right with the primers we recently ordered.

Here are the sequences we submitted to IDT, with the bold type being the Nextera tail sequence.

NS31_Nex - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTGGAGGGCAAGTCTGGTGCC
AML2_Nex - GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGAACCCAAACACTTTGGTTTCC

Any insight would be great!