library preparation for Illumina sequencing

[Schelarina]

Hello everybody,
I have little experience with library preparation and Illumina sequencing . I just want to know if it makes sense what I am planning to do.
I have to generate multiplex libraries to perform mRNA-Seq with Illumina.
I have to create a library similar to the PARE as I am interested in mRNA processing products (but I am not going to use the mmeI and oligo dT cDNA synthesis). The degraded mRNA will be ligated to a 5' RNA adapter, followed by fragmentation, cDNA synthesis with random primer holding a tag, PCR amplified and sequenced. What is the range in the length of RNA fragmented products? PCR products have to be purified prior to sequencing?
I wonder if I can use the Illumina 5' adaptor 5' GUUCAGAGUUCUACAGUCCGACGAUC (like in TruSeq small RNA library prep) and a random primer holding as tag the Illumina 3' adaptor sequence 5'TGGAATTCTCGGGTGCCAAGG and PCR with Illumina RNA PCR Primers index 1-48. When sending for sequencing which service do I have to use then? small RNA seq with HiSeq2000 even though I am not sequencing small RNAs?
Can I purchase only these adapters and primers from Illumina ? I just know that I can buy the multiplex primers, but what about adapters?
Thank you very much
S.

[Schelarina]

mmm no answers yet.. it means that there is something wrong or not clear?

[williamhorne]

You could of called tech support and gotten your answer much easier. But No you cannot just purchase the adapters. You could just use IDT to create adapters that you want for much much cheaper.

First question is why are you doing it this way? Just so you know the the Illumina adapters are 60 bp in length on each of the 5 and 3 prime ends and include more than just the adapter index.

Interested in exactly what you are trying to do here and why?