PE Adaptors

cement_head

Senior Member

Join Date: Mar 2012
Posts: 264

08-25-2017, 07:08 AM

In the lastest Illumina Sequence Letter, the Paired End DNA Oligonucleotides are now listed as "Obsolete". Does that mean/imply that they will no longer work on HiSeq2500 (and MiSeq) flow cells?

Code:

Oligonucleotide Sequences for Paired End DNA
(Obsolete)
PE Adapters
5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 2.0
5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
PE Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE Read 2 Sequencing Primer
5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

Tags: pe adaptors

cement_head

Senior Member

Join Date: Mar 2012

Posts: 264
- Share
- Tweet
#2

08-25-2017, 10:39 AM

No, it means that Illumina no longer "SELLS" these adaptors...
Comment

Previous template Next

From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data

by SEQadmin2

Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.

The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...
- Channel: Articles
06-02-2026, 10:05 AM
Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends

by SEQadmin2

With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.

Introduction

Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
- Channel: Articles
05-22-2026, 06:42 AM

Topics	Statistics	Last Post
Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2 Started by SEQadmin2, 06-09-2026, 11:58 AM	0 responses 13 views 0 reactions	Last Post by SEQadmin2 06-09-2026, 11:58 AM
A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2 Started by SEQadmin2, 06-05-2026, 10:09 AM	0 responses 26 views 0 reactions	Last Post by SEQadmin2 06-05-2026, 10:09 AM
A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2 Started by SEQadmin2, 06-04-2026, 08:59 AM	0 responses 36 views 0 reactions	Last Post by SEQadmin2 06-04-2026, 08:59 AM
Long-Read RNA Sequencing Uncovers a Hidden Layer of Immune Cell Regulation by SEQadmin2 Started by SEQadmin2, 06-02-2026, 12:03 PM	0 responses 60 views 0 reactions	Last Post by SEQadmin2 06-02-2026, 12:03 PM

Unconfigured Ad

PE Adaptors

Comment

Latest Articles

ad_right_rmr

News