Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Multiplex adapters and indexes for Illumina HiSeq

    Dear all,
    we are planning on multiplexing our samples in the new HiSeq Illumina we have available. The kits are so extremely expensive that they are not even an option . But many people told us that we can get our own primers/adapters/indexes custom made from IDT. We got custom made adapters for paired end sequencing with the GA and they had a phosphorothioate bond.
    Has anybody got these things custom made and know how are all of them purified?
    Thanks!!

  • #2
    The truseq kits from illumina are more reasonably priced than the previous generation (~$50/sample for enzymes and oligos).

    We have had success ordering from IDT with HPLC purification. For multiplex, I recommend using a two primer system (illumina index and PCR 2.0 sequence designed as a single primer).

    Comment


    • #3
      Hi upenn_ngs,
      thanks a lot for your answer. We did not get the TruSeq kit because ordering pretty much everything from IDT was 1/3 of the price...If they decrease the price that much we would start thinking about it....or if the custom made stuff don't work.
      And thanks for the tip about pcr primers and indexes, but what exactly you mean with pcr 2.0 designed as a single primer?
      Thanks!

      Comment


      • #4
        We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.

        Comment


        • #5
          Thanks upenn_ngs!
          But i have a new question.
          We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
          Thanks!

          Comment


          • #6
            Originally posted by alisrpp View Post
            Thanks upenn_ngs!
            But i have a new question.
            We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
            Thanks!
            In my hands, I was unable to reliably produce libraries with the three primer scheme. But move forward and hold your fingers crossed.

            Comment


            • #7
              We're now going to get all our adapters and primers from Bioo. The price is now very reasonable and it just doesn't make sense to anneal these ourselves.

              Comment


              • #8
                Originally posted by upenn_ngs View Post
                We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
                Hi upenn_ngs:
                Thanks for your contributions to the forum. We are trying to multiplex using the two primer system you described. Although we have designed the Universal Primer and a number of Index Primers no problem, we're not completely sure what 5' and 3' primer modifications to these are necessary. So far, we've gathered that the Universal Primer requires a 5' phosphate and a 3' phosphorothioate, while the indexing primers don't require any 5' or 3' modifications. Can you or anyone else who's had luck with this system confirm that this info is correct? Thanks in advance!

                Comment


                • #9
                  Hi All,

                  We are also planning on using the Illumina multiplexing system to sequence restriction fragments on a HiSeq machine. The prior comments seem to indicate that Illumina's 3-primer approach is problematic. If we adopt the suggested 2-primer approach, should I simply combine the PCR Primer 2 and PCR Index Primer sequences, yielding the following oligo design:
                  5'CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3' ?

                  If anyone is aware of necessary primer modifications beyond this, I'd really appreciate your advice.

                  Also, is it possible to use additional index sequences, if I would like more than the 12 designed by Illumina?

                  Thanks very much!

                  Comment


                  • #10
                    Check out Meyer & Kircher 2010 CSH protocols

                    Comment


                    • #11
                      Originally posted by jakeenk View Post
                      Check out Meyer & Kircher 2010 CSH protocols
                      Do you happen to have a pdf of this as I don't have a password to access the full text?

                      Cheers - H

                      Comment


                      • #12
                        yup, and http://cshprotocols.cshlp.org/cgi/co...b.prot5448/DC1
                        Attached Files

                        Comment


                        • #13
                          Great stuff, thanks jakeenk..

                          Comment


                          • #14
                            Originally posted by upenn_ngs View Post
                            We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
                            Hi upenn_ngs,

                            We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!

                            -CS

                            Comment


                            • #15
                              Originally posted by csmall View Post
                              Hi upenn_ngs,

                              We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!

                              -CS
                              Attached is the most recent working protocol including primer sequence and modifications. This protocol is buried in another thread somewhere in the forum. First half = sample prep; second half = enrichment.
                              Attached Files

                              Comment

                              Latest Articles

                              Collapse

                              • seqadmin
                                Essential Discoveries and Tools in Epitranscriptomics
                                by seqadmin




                                The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                                04-22-2024, 07:01 AM
                              • seqadmin
                                Current Approaches to Protein Sequencing
                                by seqadmin


                                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                                04-04-2024, 04:25 PM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by seqadmin, 04-25-2024, 11:49 AM
                              0 responses
                              19 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-24-2024, 08:47 AM
                              0 responses
                              20 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-11-2024, 12:08 PM
                              0 responses
                              62 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 10:19 PM
                              0 responses
                              61 views
                              0 likes
                              Last Post seqadmin  
                              Working...
                              X