Multiplex adapters and indexes for Illumina HiSeq

[arg]

Dear all,
we are planning on multiplexing our samples in the new HiSeq Illumina we have available. The kits are so extremely expensive that they are not even an option . But many people told us that we can get our own primers/adapters/indexes custom made from IDT. We got custom made adapters for paired end sequencing with the GA and they had a phosphorothioate bond.
Has anybody got these things custom made and know how are all of them purified?
Thanks!!

[upenn_ngs]

The truseq kits from illumina are more reasonably priced than the previous generation (~$50/sample for enzymes and oligos).

We have had success ordering from IDT with HPLC purification. For multiplex, I recommend using a two primer system (illumina index and PCR 2.0 sequence designed as a single primer).

[arg]

Hi upenn_ngs,
thanks a lot for your answer. We did not get the TruSeq kit because ordering pretty much everything from IDT was 1/3 of the price...If they decrease the price that much we would start thinking about it....or if the custom made stuff don't work.
And thanks for the tip about pcr primers and indexes, but what exactly you mean with pcr 2.0 designed as a single primer?
Thanks!

[upenn_ngs]

We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.

[alisrpp]

Thanks upenn_ngs!
But i have a new question.
We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
Thanks!

[upenn_ngs]

Thanks upenn_ngs!
But i have a new question.
We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
Thanks!

In my hands, I was unable to reliably produce libraries with the three primer scheme. But move forward and hold your fingers crossed.

[RNAseqer]

We're now going to get all our adapters and primers from Bioo. The price is now very reasonable and it just doesn't make sense to anneal these ourselves.

[parasitehunter]

We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.

Hi upenn_ngs:
Thanks for your contributions to the forum. We are trying to multiplex using the two primer system you described. Although we have designed the Universal Primer and a number of Index Primers no problem, we're not completely sure what 5' and 3' primer modifications to these are necessary. So far, we've gathered that the Universal Primer requires a 5' phosphate and a 3' phosphorothioate, while the indexing primers don't require any 5' or 3' modifications. Can you or anyone else who's had luck with this system confirm that this info is correct? Thanks in advance!

[csmall]

Hi All,

We are also planning on using the Illumina multiplexing system to sequence restriction fragments on a HiSeq machine. The prior comments seem to indicate that Illumina's 3-primer approach is problematic. If we adopt the suggested 2-primer approach, should I simply combine the PCR Primer 2 and PCR Index Primer sequences, yielding the following oligo design:
5'CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3' ?

If anyone is aware of necessary primer modifications beyond this, I'd really appreciate your advice.

Also, is it possible to use additional index sequences, if I would like more than the 12 designed by Illumina?

Thanks very much!

[jakeenk]

Check out Meyer & Kircher 2010 CSH protocols

[HGENETIC]

Check out Meyer & Kircher 2010 CSH protocols

Do you happen to have a pdf of this as I don't have a password to access the full text?

Cheers - H

[jakeenk]

yup, and http://cshprotocols.cshlp.org/cgi/co...b.prot5448/DC1

[HGENETIC]

yup, and http://cshprotocols.cshlp.org/cgi/co...b.prot5448/DC1

Great stuff, thanks jakeenk..

[csmall]

We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.

Hi upenn_ngs,

We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!

-CS

[upenn_ngs]

Hi upenn_ngs,

We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!

-CS

Attached is the most recent working protocol including primer sequence and modifications. This protocol is buried in another thread somewhere in the forum. First half = sample prep; second half = enrichment.