Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Rosmano
    Member
    • May 2012
    • 28

    Unable to do library amplification using the new Nextera DNA Flex Library Prep kit

    Hello everyone,

    I am trying to do a library of FACS sorted T-cells using the new Nextera DNA Flex Library Prep kit to perform ATAC-seq.
    We are using adapters ordered from Sigma that have the same sequence as the Illumina ones:

    Ad1 - AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
    Ad 2.1 - CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
    Ad 2.2 - CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT

    I've already tested the following parameters:
    - Tested different amounts of cells - 25k, 50k, 75k;
    - Removed the final bead purification step and changed it by a MinElute column purification - when I performed this, my Bioanalyzer profile showed an enormous amount of adapter dimers and no library amplification at all;

    Finally, Illumina had the following information in their page for the discontinued Nextera DNA Library Prep Kit:

    The Nextera DNA Library Prep Kit has been obsolesced. For whole-genome sequencing, Nextera DNA Flex Library Prep Kit is the recommended replacement product. For ATAC-seq and other custom applications, contact your local Illumina Sales representative to order stand-alone components TDE1 Tagment DNA Enzyme (Catalog No. 15027865) and TD Tagment DNA Buffer (Catalog No. 15027866). Illumina remains committed to providing you with high-quality support and service.
    However, they've since made that page redirect to the new kit and now that information is no longer available. Has anyone been able to make the kit work?
  • Rosmano
    Member
    • May 2012
    • 28

    #2
    As an update, I contacted Illumina and they said they haven't text the Nextera DNA flex kit for ATAC-seq.

    Or if anyone has any suggestion of an alternative kit that I can use I would welcome such a suggestion.
    I know I can order the TDE1 enzyme and TD bufer directly from Illumina but I am willing to study alternatives since apparently they're not interested in providing an easy way to obtain these reagents, which is a pity since I want to follow the Buenruostro protocol (or the Omni-ATAC one).
    Last edited by Rosmano; 04-03-2019, 02:08 AM.

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 11:05 AM
    0 responses
    7 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-02-2026, 11:08 AM
    0 responses
    28 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    27 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Working...