Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • HOnsbring
    Junior Member
    • Apr 2016
    • 3

    Hello anna.85,

    I work with poorly studied microbes, so I have to assemble my data de novo. Therefore contamination can be extra problematic for me since I do not map my reads to a reference. I take extra precautions such as UV irradiating all reagents and tubes before use except the primers, RNase inhibitor, KAPA and SSII polymerase. I do the UV irradiation in a crosslinker from techtum.

    However, the SSII polymerase seems to be contaminated some times and then the situation is much harder. If the cell you work with is rather big and give a high yield of cDNA such contamination should not be too much of a problem according to my experience.

    Comment

    • anna.85
      Junior Member
      • Apr 2016
      • 5

      Hi Adamreid,
      we have exactly the same situation (see post #225 in thi section)!!!
      we did a single cell exp following the SMARTSeq2 protocol and we got lots of 16s bacteria contamination.
      We run lots of tests (16S PCR ) with multiple conditions (different kind of cells, cells post-sorting, cells post RT, cells post PCR cleaning etc) and, by exclusion, we think that the SSII is contaminated, whereas we see the PCR bands for the 16S only after 2 run of PCR amplification.

      we are thinking to use the Maxima H-...
      Did you manage to solve your problem?

      Comment

      • anna.85
        Junior Member
        • Apr 2016
        • 5

        Originally posted by adamreid View Post
        We are trying to sequence RNA from individual small cells.

        We are sorting by FACS and using SmartSeq2 and Nextera XT to make libraries.

        We have had several problems.

        We get rRNA contamination from both E. coli (perhaps due to contaminated reverse transcriptase) and from our target organism. This is strange because SmartSeq2 should only amplify polyA mRNAs.

        Secondly when we sequence the libraries we get adaptor contamination, sometimes from the strand-switching oligo and also from the Nextera transposase.

        Has anyone noticed similar problems?

        Cheers,

        Adam
        Hi Adamreid,
        we have exactly the same situation (see post #225 in thi section)!!!
        we did a single cell exp following the SMARTSeq2 protocol and we got lots of 16s bacteria contamination.
        We run lots of tests (16S PCR ) with multiple conditions (different kind of cells, cells post-sorting, cells post RT, cells post PCR cleaning etc) and, by exclusion, we think that the SSII is contaminated, whereas we see the PCR bands for the 16S only after 2 run of PCR amplification.

        we are thinking to use the Maxima H-...
        Did you manage to solve your problem?

        Comment

        • anna.85
          Junior Member
          • Apr 2016
          • 5

          Originally posted by Simone78 View Post
          I had the same problem when working with innate lymphoid cells. Immune cells are small and have much less RNA than, for example, cell lines.
          My advice is to block all the oligos with biotin (all!), increasing the number of PCR cycles (23 should be fine), make your own magnetic beads (according to the Rohland & Reich, Genome Res 2010 paper) and using a buffer with a lower % of PEG in order to increase the cutoff (if you are interested I can give you the details), using an oligodT with "V" and not "VN" in the end to avoid weird pairing with the 2 rG in the end of the TSO, as suggested in some papers (for example, look for the "CATS" paper in another thread on this forum). I would also play with oligodT conc (reducing it sometimes help a lot) but I wouldn´t touch the TSO conc.
          Some (but not all) of these changes are described in the method part of our last paper --> PMID: 26878113

          /Simone
          Hi Simone,
          In your last paper (PMID:26878113 ) in M&M is written you used 10U/uL of RNase inhibitor in lysis buffer.
          If so, according to the volume you used, 1.9uL of Triton 0,4% and 0,1 uL of RNase inhibitor, the stock concentration of RNase should be 200U/uL…
          I cannot find this RNase inhibitor, can you help me?
          I was wondering if maybe it is a typo and it is 1U/uL…

          Comment

          • kishorebiotech
            Junior Member
            • Sep 2012
            • 1

            Read Length discrepancy

            Hi Simone, I was looking at Bioanalyzer traces from Pg.180 of your paper (PMID: 24385147). What do you think about the size discrepancy between MEF cell at 2Kb vs T cell 700bp. I see a hump from T-cell at 2Kb. Do you think the hump(@2Kb) is the real peak and the 700bp some kind of artifact or RNA degradation?

            Comment

            • iamahappyann
              Junior Member
              • Aug 2011
              • 1

              Hi All,

              Thank you for all your contribution to this topic, especially Simone. I learned a lot from it and started to prepare my scRNA form my project.

              I have a stupid question about the oligoDT primer: why all the scRNA-seq methods use CDS to olidodT instead of using olidodtVN?
              CDS-oligodtVN: 5'>AAGCAGTGGTATCAACGCAGAGTACT30VN ; OligodtVN: 5'>T30VN.

              I understand that the CDS sequence is the same as TSO sequence, so one ISPCR primers could be used for amplification.
              But it is necessary to use single PCR primer? Could the OligodtVN used for cDNA synthesis and Oligodt+ISPCR for cDNA amplification?

              Thank you in advance.

              Comment

              • HOnsbring
                Junior Member
                • Apr 2016
                • 3

                iamahappyyann, you could probably make it work. However I guess you would get lower yield. Adding the primer according to Smartseq2 gives you higher effective primer concentration compared to if you use the same total molar of ISPCR + oligodT.

                Also using only one primer give you this suppression effect: http://www.evrogen.com/img/PCR-supression-large.png which you will not get if you use ISPCR + oligodT.

                Comment

                • AiryLarry
                  Junior Member
                  • Jul 2015
                  • 1

                  Hi Simone, can we substitute SmartScribe for Maxima -H in your SmartSeq protocol without changing the rest of the reagents like RNAseH etc?

                  cheers!

                  Comment

                  • chubukovp
                    Junior Member
                    • Jul 2013
                    • 1

                    Originally posted by Simone78 View Post
                    Hi,
                    even if your cells have a lot of RNA I wouldn´t do it. This is only my opinion, others might think differently. Every time you transfer RNA before any amplification step you lose molecules. I would sort directly into the lysis buffer, but be aware that 0.2% Triton might not be sufficient for lysing so many cells.
                    Best,
                    Simone
                    Simone, could you clarify:
                    did you use Betaine+6mM Mg2+ with supplied superscript IV buffer, or you used the buffer from SMART-seq2 protocol? The tech support from Life Tech say that the buffer is the most important part of SSIV system.
                    Also, if the 3bp hybridization during 5' switch is an issue, could it be useful to lower the temperature to 25-37C for a short time to enhance the switch?

                    Comment

                    • SunPenguin
                      Member
                      • Aug 2015
                      • 38

                      Has anyone here looked at what the TSO would be doing in subsequent PCR reactions (i.e. could it cause TSO founded amplification)?

                      Comment

                      • Steve giant
                        Junior Member
                        • Mar 2016
                        • 2

                        Superscript-II - contamination issue

                        Hello everybody,

                        I also got bad results in my single cell application (WTA) with a recently acquired batch of Superscript II
                        I followed your advice on complaining to Life Technologies about the SSII contamination.
                        Actually, they have set-up an assay to detect contaminations originating from E. coli.

                        My and their question is to know the acceptable level of contamination for single cell WTA applications. I mean the number of copies of contaminating nucleic acid for each mg or Unit of enzyme.

                        Zero cannot work, is not feasible in a purification process.

                        What's your suggestion?

                        Thank you.

                        S.

                        Comment

                        • JJMS
                          Junior Member
                          • Jan 2013
                          • 5

                          TSO in qPCR

                          Originally posted by SunPenguin View Post
                          Has anyone here looked at what the TSO would be doing in subsequent PCR reactions (i.e. could it cause TSO founded amplification)?
                          Hi SunPenguin, yes we did. We are sorting single B cells and before we send for sequencing we apply a qPCR panel to test for T/B/NK presence. If the transcripts are there you'll find the expected singnal back with qPCR. But if the samples are negative (f.i. CD56 qPCR on a sorted T cell) then often we see a complete jungle of bands. If it's the TSO or oligo-dT, I don't know but we have to run an agarose gel afterwards to be sure.

                          Comment

                          • ipeikon
                            Junior Member
                            • Nov 2011
                            • 4

                            rRNA reads from bacteria

                            Hi all,

                            I'm also seeing issues with lots of rRNA - mostly from bacteria (23s?). I'm curious if when you have super low input RNA this is more common. One thought is that I could reduce the oligoDT concentrations. Has anyone tried this?

                            Note: I do not think my contamination is coming from the RT enzyme. I am using Maxima RH- and also most of the bacterial species I see make sense considering my tissue source.

                            -Ian

                            Comment

                            • Steve giant
                              Junior Member
                              • Mar 2016
                              • 2

                              Originally posted by ipeikon View Post
                              Hi all,

                              I'm also seeing issues with lots of rRNA - mostly from bacteria (23s?). I'm curious if when you have super low input RNA this is more common. One thought is that I could reduce the oligoDT concentrations. Has anyone tried this?

                              Note: I do not think my contamination is coming from the RT enzyme. I am using Maxima RH- and also most of the bacterial species I see make sense considering my tissue source.

                              -Ian
                              Hi Ian,

                              in my samples, the 2 main represented transcripts are 16S and 23S ribosomal RNA.
                              Remaining reads match RNAseP, 50S ribosomal subunit genes.

                              Obviously, the contamination is inversely proportional to the amount of input RNA as a result of a different ratio between the different substrates (specific targets and contaminants). I didn't try to reduce oligoDT concentration.

                              I'll keep you up-to-date.

                              S.

                              Comment

                              • wanze
                                Junior Member
                                • Jul 2016
                                • 1

                                rRNA and mitochondria RNA

                                Originally posted by adamreid View Post
                                We are trying to sequence RNA from individual small cells.

                                We are sorting by FACS and using SmartSeq2 and Nextera XT to make libraries.

                                We have had several problems.

                                We get rRNA contamination from both E. coli (perhaps due to contaminated reverse transcriptase) and from our target organism. This is strange because SmartSeq2 should only amplify polyA mRNAs.

                                Secondly when we sequence the libraries we get adaptor contamination, sometimes from the strand-switching oligo and also from the Nextera transposase.

                                Has anyone noticed similar problems?

                                Cheers,

                                Adam

                                Hi Adam and all,

                                I also have that problem and do not know why. When I sequence the library, , 40% of the unique mapped reads are 18s RNA and mitochondrial RNA. I am using the LNA-TSO (all oligos and PCR primers are biotinated) and Maxima H- RTase.

                                I also have two weird peaks at around 1.3 kb and 1.8 kb in the cDNA profile, even when I use 10 pg purified total RNA as input. I think the 1.8kb peak might be the 18s rRNA. But since it is reverse transcripted with oligo-dT, it does not make sense.

                                Have anyone saw and solved that problem?

                                ps. When I use supersciptII with the other setting exactly the same, the two peaks disappear, but with many peaks around 600 bp, which we all know is the E.coli RNA contamination.

                                Best,
                                Wanze
                                Attached Files

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by SEQadmin2


                                  I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


                                  Here are nine questions we think about, in roughly the order they matter, before...
                                  06-18-2026, 07:11 AM
                                • SEQadmin2
                                  From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                                  by SEQadmin2


                                  Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                                  The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                                  ...
                                  06-02-2026, 10:05 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 06-17-2026, 06:09 AM
                                0 responses
                                30 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-09-2026, 11:58 AM
                                0 responses
                                44 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-05-2026, 10:09 AM
                                0 responses
                                50 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-04-2026, 08:59 AM
                                0 responses
                                51 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...