Qiagen has a new single cell RNA kit based on REPLI-g technology that our group is testing (early access). We are excited to test out the performance and will report back here with some QC, yields and prelim data.
Unconfigured Ad
Collapse
X
-
Virtually every WGA method shows bias and drop outs
Single-cell sequencing is emerging as an important tool for studies of genomic heterogeneity. Whole genome amplification (WGA) is a key step in single-cell sequencing workflows and a multitude of methods have been introduced. Here, we compare three state-of-the-art methods on both bulk and single-cell samples of E. coli DNA: Multiple Displacement Amplification (MDA), Multiple Annealing and Looping Based Amplification Cycles (MALBAC), and the PicoPLEX single-cell WGA kit (NEB-WGA). We considered the effects of reaction gain on coverage uniformity, error rates and the level of background contamination. We compared the suitability of the different WGA methods for the detection of copy-number variations, for the detection of single-nucleotide polymorphisms and for de-novo genome assembly. No single method performed best across all criteria and significant differences in characteristics were observed; the choice of which amplifier to use will depend strongly on the details of the type of question being asked in any given experiment.
Comment
-
Are there any rRNA removal kits that go lower than 10ng? I don't understand biologically why one couldn't remove rRNA from picograms of input.
Comment
-
It can be done but results may not be optimal because some RNA will be lost and some of rRNA probes may end up in purified RNA. Kits’ recommendations are based on testing various input quality which would give optimal results in downstream applications.
Comment
-
Hi guys,
I have two practical questions about the application of primers.
1) in PCR preamplification, the protocol suggests IS PCR primers final concentration at 0.1 uM, which is lower than the recommended concentration by KAPA kit (0.3 + 0.3 uM); I have not used KAPA kit before, actually with the common high fedelity PCR kit we used in lab, we use even higher concetration of primers (0.5 + 0.5 uM). So I am wondering is there any special reason to use a relatively low concentration of IS PCR primers?
2) Another question is the stability of TSO (with LNA-modified G), if I run the experiment more than once per day, can I just leave the TSO (a small aliquot) on ice for a few hours?
Thanks a lot!
Comment
-
The reason was that I had a lot of primer dimers and I noticed that decreasing the amount of ISPCR primers improved things a bit. If you block the ISPCR primers with a biotin at the 5´-end (as well as the TSO and oligo dT) you won´t have this problem and you can use a higher conc (0.25 uM was what we normally use but Clontech uses 0.5 uM I think).Originally posted by wishingfly View PostHi guys,
I have two practical questions about the application of primers.
1) in PCR preamplification, the protocol suggests IS PCR primers final concentration at 0.1 uM, which is lower than the recommended concentration by KAPA kit (0.3 + 0.3 uM); I have not used KAPA kit before, actually with the common high fedelity PCR kit we used in lab, we use even higher concetration of primers (0.5 + 0.5 uM). So I am wondering is there any special reason to use a relatively low concentration of IS PCR primers?
The TSO is not as sensitive as one might think. We store it at -80 simply because Clontech was doing so with the TSO in the Smarter kit. However, since our -80 freezer is in the basement and I am lazy, I keep it at -20 for weeks and haven´t noticed any change in activity, even after repeated freeze-thaw cycles.Originally posted by wishingfly View Post2) Another question is the stability of TSO (with LNA-modified G), if I run the experiment more than once per day, can I just leave the TSO (a small aliquot) on ice for a few hours?
Thanks a lot!
Comment
-
I re-read all the threads discussed previously and got a better idea of issue of primer dimers and concatetmer. So if I choose to use biotin 5'-mod with ISPCR, shall I apply the same thing with TSO and oligo dT as well, I mean ALL or NONE? Is there any cons in using biotin? For instance, do I have to change the PCR condition specifically for biotin blocked-primers (and my samples)? Do I suffer with possible lower yield or replicability? Since our samples are relatively precious, we cann't afford too many trials, even though moderate optimization is necessary. Thank you so much!Originally posted by Simone78 View PostThe reason was that I had a lot of primer dimers and I noticed that decreasing the amount of ISPCR primers improved things a bit. If you block the ISPCR primers with a biotin at the 5´-end (as well as the TSO and oligo dT) you won´t have this problem and you can use a higher conc (0.25 uM was what we normally use but Clontech uses 0.5 uM I think).
That is good to know, we kind of want to keep the TSO on ice for a few hours, for more than one library clones the same day. I hope it is safe.Originally posted by Simone78 View PostThe TSO is not as sensitive as one might think. We store it at -80 simply because Clontech was doing so with the TSO in the Smarter kit. However, since our -80 freezer is in the basement and I am lazy, I keep it at -20 for weeks and haven´t noticed any change in activity, even after repeated freeze-thaw cycles.Last edited by wishingfly; 06-01-2015, 09:22 AM.
Comment
-
I am using only blocked primers now. Based on what I have seen while working with many different cell types (cell lines, immune and cancer cells) it doesn´t see to be that crucial to block all the primers when working with big cells (cell lines, like HEK293, HeLa, etc) but it is very important when working with small cells (T and B cells, for example) in order not to get a library of only adaptor dimers. If your samples are new/precious I would block all the primers. No modifications in the protocol are needed.Originally posted by wishingfly View PostI re-read all the threads discussed previously and got a better idea of issue of primer dimers and concatetmer. So if I choose to use biotin 5'-mod with ISPCR, shall I apply the same thing with TSO and oligo dT as well, I mean ALL or NONE? Is there any cons in using biotin? For instance, do I have to change the PCR condition specifically for biotin blocked-primers (and my samples)? Do I suffer with possible lower yield or replicability? Since our samples are relatively precious, we cann't afford too many trials, even though moderate optimization is necessary. Thank you so much!
Nothing will happen. probably it´s even better than in and out of the freezer.Originally posted by wishingfly View PostThat is good to know, we kind of want to keep the TSO on ice for a few hours, for more than one library clones the same day. I hope it is safe.
Comment
-
Thank you so much for your timely reply (as always). I am almost ready to place the order of primers, before that, would you mind helping me have a check of the primers to make sure I correctly understand what you suggested:Originally posted by Simone78 View PostI am using only blocked primers now. Based on what I have seen while working with many different cell types (cell lines, immune and cancer cells) it doesn´t see to be that crucial to block all the primers when working with big cells (cell lines, like HEK293, HeLa, etc) but it is very important when working with small cells (T and B cells, for example) in order not to get a library of only adaptor dimers. If your samples are new/precious I would block all the primers. No modifications in the protocol are needed.
TSO: 5‘-/5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3′
Oligo-dT: 5‘-/5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN-3′
ISPCR: 5‘-/5Biosg/AAGCAGTGGTATCAACGCAGAGT-3′
in which /5Biosg/ means 5' modification of biotin. There is no major modification of the RT and PCR condition, except increasing the [ISPCR primer final concentration] to 0.25 uM.
By the way, we are working with neurons, actually a relatively smaller neurons compared with classic pyramidal neurons in cortex or hippocampus, so I would assume to follow your experience with "small cells" like B cells and T cells. Any other suggestions is appreciated. Thank you so much!
Comment
-
Sequences are fine! And the amount of primers is what I am currently using.Originally posted by wishingfly View PostThank you so much for your timely reply (as always). I am almost ready to place the order of primers, before that, would you mind helping me have a check of the primers to make sure I correctly understand what you suggested:
TSO: 5‘-/5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3′
Oligo-dT: 5‘-/5Biosg/AAGCAGTGGTATCAACGCAGAGTACT30VN-3′
ISPCR: 5‘-/5Biosg/AAGCAGTGGTATCAACGCAGAGT-3′
in which /5Biosg/ means 5' modification of biotin. There is no major modification of the RT and PCR condition, except increasing the [ISPCR primer final concentration] to 0.25 uM.
You probably have to run some tests before, I think (I never worked with neurons). If you use Nextera for the final library preparation you need only few hundreds picograms of cDNA. Therefore, you don´t need to use too many cycles of PCR after RT. As long as you get few nanograms you are fine, in case something goes wrong and you have to repeat the tagmentation.Originally posted by wishingfly View PostBy the way, we are working with neurons, actually a relatively smaller neurons compared with classic pyramidal neurons in cortex or hippocampus, so I would assume to follow your experience with "small cells" like B cells and T cells. Any other suggestions is appreciated. Thank you so much!
Best,
Simone
Comment
-
Sure, some test runs before bulk processing is a necessary step, thanks for the reminder! Since you mentioned the cycles of PCR, I plan to go with the default protocol of 18 cycles, do you think it makes sense, according to your experience with small cells like T cells? I read somewhere saying "fewer cycles is better than too many", to make sure no fragment reaches the plateau; but of course that depends on RNA input, and nobody could tell before on-hand trials; we have to bet the 18 cycles' amplification works, at least not too much off. Thanks a lot!Originally posted by Simone78 View PostYou probably have to run some tests before, I think (I never worked with neurons). If you use Nextera for the final library preparation you need only few hundreds picograms of cDNA. Therefore, you don´t need to use too many cycles of PCR after RT. As long as you get few nanograms you are fine, in case something goes wrong and you have to repeat the tagmentation.
Best,
Simone
Comment
-
With T cells I need 21-22 cycles to be able to see something in the Bioanalyzer. Conc is about 100-300 pg/ul in a final elution volume of 15-20 ul, so we get just few nanograms even after so much amplification. Fewer cycles would be better of course but the RNA content of these cells is so low that we have to use more. You could try 18, 20 and 22 and see how it goes. In the end you need only a couple of nanograms for the Nextera (experiment + some extra in case it fails).Originally posted by wishingfly View PostSure, some test runs before bulk processing is a necessary step, thanks for the reminder! Since you mentioned the cycles of PCR, I plan to go with the default protocol of 18 cycles, do you think it makes sense, according to your experience with small cells like T cells? I read somewhere saying "fewer cycles is better than too many", to make sure no fragment reaches the plateau; but of course that depends on RNA input, and nobody could tell before on-hand trials; we have to bet the 18 cycles' amplification works, at least not too much off. Thanks a lot!
Comment
-
We just started using this protocol with mouse and human single-cell neurons. 18-19 cycles works fine for most of the cell types we have run through (so far). With bulk RNA, this protocol yields a very consistent 2.5ng under 19 cycles.Originally posted by wishingfly View PostSure, some test runs before bulk processing is a necessary step, thanks for the reminder! Since you mentioned the cycles of PCR, I plan to go with the default protocol of 18 cycles, do you think it makes sense, according to your experience with small cells like T cells? I read somewhere saying "fewer cycles is better than too many", to make sure no fragment reaches the plateau; but of course that depends on RNA input, and nobody could tell before on-hand trials; we have to bet the 18 cycles' amplification works, at least not too much off. Thanks a lot!
Nextera is also not too difficult to miniaturize, which would not only save you a ton of money, but allow you to use even less input.
Comment
-
Originally posted by Simone78 View PostWith T cells I need 21-22 cycles to be able to see something in the Bioanalyzer. Conc is about 100-300 pg/ul in a final elution volume of 15-20 ul, so we get just few nanograms even after so much amplification. Fewer cycles would be better of course but the RNA content of these cells is so low that we have to use more. You could try 18, 20 and 22 and see how it goes. In the end you need only a couple of nanograms for the Nextera (experiment + some extra in case it fails).
Thank you guys for the constructive input; I think I will start with 18 cycles and see. So in the following QC step, I am supposed use bioanalyzer to check the cDNA yield and length, right? The picoGreen to check the total DNA concentration is kind of useless, isn't it? I am wondering do you really check each indiviaual library of single-cell? In a previous thread of this sery, someone mentioned it makes no sense to check each individual library with bioanalyzer because the input from single cell is too low; actually I got the same information from the sequencing facility director at my institute. However, from Simone's paper, as well as many other publication, it seems people did check single-cell cDNA library individually as QC. So I am confused whether should I pooled 5-10 libraries (or more) of the same condition or check each individual.Originally posted by BertBertagnolli View PostWe just started using this protocol with mouse and human single-cell neurons. 18-19 cycles works fine for most of the cell types we have run through (so far). With bulk RNA, this protocol yields a very consistent 2.5ng under 19 cycles.
Nextera is also not too difficult to miniaturize, which would not only save you a ton of money, but allow you to use even less input.
Anyway, I have not reached that step, I just want to collect some suggestion so as to plan ahead (of how many pilot runs shall I do in the first round trial). Thanks a lot!
Comment
-
Both after the first (pre-ampl after RT) and the second (enrichment PCR after tagmentation) PCR you should check your library on the Bioanalyzer. The first time to see you got cDNA and it is worth continuing. The second to see the final library looks fine. Before sequencing I normally check the final library (final pool) on the Bioanalyzer for size and on the Qubit for the concentration (Bioanalyzer is semi-quantitative and not accurate for conc).Originally posted by wishingfly View PostThank you guys for the constructive input; I think I will start with 18 cycles and see. So in the following QC step, I am supposed use bioanalyzer to check the cDNA yield and length, right? The picoGreen to check the total DNA concentration is kind of useless, isn't it? I am wondering do you really check each indiviaual library of single-cell? In a previous thread of this sery, someone mentioned it makes no sense to check each individual library with bioanalyzer because the input from single cell is too low; actually I got the same information from the sequencing facility director at my institute. However, from Simone's paper, as well as many other publication, it seems people did check single-cell cDNA library individually as QC. So I am confused whether should I pooled 5-10 libraries (or more) of the same condition or check each individual.
Anyway, I have not reached that step, I just want to collect some suggestion so as to plan ahead (of how many pilot runs shall I do in the first round trial). Thanks a lot!
In the paper (and during protocol optimisation) I was checking all the libraries on the Bioanalyzer, but just because the numbers were still relatively low. Now that we process hundreds or thousands of cells at the time I check randomly 11 samples for each 384-well plate, get an average conc and use that value to decide how much cDNA I should take for tagmentation. Therefore I used equal volumes for all the samples and not equal amounts. I then do the same for the final library: I run a chip, check the average size and pool the samples using the same volumes for all the samples. It´s not optimal but it is way faster, cheaper and the only feasible way (as far as I know) when you deal with many samples. Drawback: you are pooling also failed/empty wells as well as libraries that were good with others that were very low. Result: you will get huge differences in the number of mapped reads between cells. But, again, I don´t care so much since the cells with few reads can be discarded or the pool resequenced. When working with thousands of cells, even discarding 10% of the cells still give you plenty of information.
Illumina has some normalisation beads which, as far as I can tell from the limited tests I did, work very well. But it is an extra step...and I am trying to get rid of the bead purification steps, not adding new ones!
If your final libraries have a lot of primer dimers that were not removed in the final bead purification, pooling the way I said will generate a lot of reads that have to be discarded, because you will sequence a lot of adaptor dimers (being shorter than your library they will cluster preferentially on the flow cell, of course).
Comment
Latest Articles
Collapse
-
by SEQadmin2
The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.
This convergence of genetics, immunology, and computation...-
Channel: Articles
09-01-2026, 05:41 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 09-03-2026, 10:22 AM
|
0 responses
22 views
0 reactions
|
Last Post
by SEQadmin2
09-03-2026, 10:22 AM
|
||
|
Started by SEQadmin2, 09-02-2026, 12:32 PM
|
0 responses
23 views
0 reactions
|
Last Post
by SEQadmin2
09-02-2026, 12:32 PM
|
||
|
Started by SEQadmin2, 08-24-2026, 10:32 AM
|
0 responses
53 views
0 reactions
|
Last Post
by SEQadmin2
08-24-2026, 10:32 AM
|
||
|
Started by SEQadmin2, 08-20-2026, 11:17 AM
|
0 responses
51 views
0 reactions
|
Last Post
by SEQadmin2
08-20-2026, 11:17 AM
|
Comment