Using "Eland" format in Bowtie

[medalofhonour]

Hello, I am new to Bowtie, so please pardon my naivety.

I have a reads file in the following format, which I suppose is the Eland format because this file has an "eland_result.txt" extension :

Example of one read record:

>HWI-EAS107_3:3:1:64:354 AAATAACTCTCCCCATTATTCTTGACCAACGTT U0 1 0 0 chr3.fa 89017297 R ..

When I run this reads file containing reads in the above format in Bowtie, I get the following output (error):

Time loading forward index: 00:00:12
Time loading mirror index: 00:00:13
Error: reads file does not look like a FASTQ file
Time for 1-mismatch full-index search: 00:00:00
Time searching: 00:00:25
Overall time: 00:00:25

Since I do not have the data in the FASTQ format, I don't think I have any other options.

Is there a way by which I can still use Bowtie with the file in the above format ?

[medalofhonour]

Or is it that the "eland_result.txt" file is already an alignment file ?

[kmcarr]

Or is it that the "eland_result.txt" file is already an alignment file ?

Bingo!

Now if you wanted to perform your own alignment using Bowtie you could just extract the read sequences from the eland_result.txt file to a FASTA file and run them through Bowtie. Since the eland_result.txt file does not contain the quality scores you can't make a FASTQ file (unless you just give mock qualities to every read).