Announcement

Collapse
No announcement yet.

Phred score of i

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Phred score of i

    Hi

    I have the following sequence off of a paired end HiSeq2000 run:

    @UNC11-SN627_0113:1:1101:1382:2135#0/1
    TTAAGGTTTTCACTGGTATAAATCTTTCTATATTGAGACAAAATTTAAGA
    +UNC11-SN627_0113:1:1101:1382:2135#0/1
    bbbeeeeegggggiiigiiiiiiiiiiiiiiiiiiihiiiihiiiiiiih

    I am trying to use FASTX to generate a box plot of phred quality scores and it cannot handle the score of "i". None of the scoring systems (sanger, illumina 1.x+, etc.) seem to use "i" as far as I can tell.

    Does anyone know what is happening here (what version I have here) and how I can generate a box plot like this would be extremely appreciated?

    Thanks

  • #2
    The latest versions of the Illumina software will assign base qulities up to 41, which would be represented as an 'i' if the FASTQ file is encoded using Illumina's Phred+64.

    Comment

    Working...
    X