which is the right conversion for Solid?

[pepperoni]

Hi, I have been using several scripts from maq, fastq-mcf and galaxy to transform my csfasta & qual data into fastq (in base space). all of them gave me the same sequence, but when I tried to do it manually based on the code given by Solid I get a different sequence. I tried a script that I found in a forum and is the only script that has coincide with my translation. Can anyone tell me which is the right conversion and which one has a frame shift please?

original .csfasta
@373_15_137_F3
T32330320332012322113122303202132003331331003110331

manual
@373_15_137_F3
AGCGGCTTATCCAGCTCACGTCTAATCCTGCTTTATACGCAAATGTTATG

scripts: maq,galaxy, fastq-mcf
@373_15_137_F3
TTGTTATGATTGACGTGGCCTCGGTATGAGCTGAATTTCTTCAATCCATTC

[Chipper]

Hi, I have been using several scripts from maq, fastq-mcf and galaxy to transform my csfasta & qual data into fastq (in base space). all of them gave me the same sequence, but when I tried to do it manually based on the code given by Solid I get a different sequence. I tried a script that I found in a forum and is the only script that has coincide with my translation. Can anyone tell me which is the right conversion and which one has a frame shift please?

original .csfasta
@373_15_137_F3
T32330320332012322113122303202132003331331003110331

manual
@373_15_137_F3
AGCGGCTTATCCAGCTCACGTCTAATCCTGCTTTATACGCAAATGTTATG

scripts: maq,galaxy, fastq-mcf
@373_15_137_F3
TTGTTATGATTGACGTGGCCTCGGTATGAGCTGAATTTCTTCAATCCATTC

The csfasta to fastq converters will not decode the sequence to basespace. The manual way is the correct conversion, but it is likely not the correct sequence given the high error rate.

[pepperoni]

Thanks Chiper, I am also filtering the low quality bases on both extremes and removing all the reads with non-called bases