Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • westerman
    Rick Westerman
    • Jun 2008
    • 1104

    #16
    I don't recognize the 'MAXINFO' parameter. Perhaps that is the problem?

    In any case was does your trimLog say? Posting the first 10 lines could be useful.

    Comment

    • westerman
      Rick Westerman
      • Jun 2008
      • 1104

      #17
      ... And I answered my own question about MAXINFO. It is a (newer) parameter that I don't use. However the manual I am looking at says that there are only two numbers associated with MAXINFO: <targetLength>:<strictness> You seem to have three numbers 0 ... 40 ... 0.5. That could be a problem.

      Comment

      • trimmoMe
        Junior Member
        • Sep 2015
        • 2

        #18
        that solved it...
        Thanks so much weterman!!

        Comment

        • FSeq
          Junior Member
          • Sep 2015
          • 1

          #19
          Originally posted by tonybolger View Post
          It's a phred score

          Historically, the illumina pipeline occasionally created reads with one (or more rarely two) N base-calls at the start, and more often, a set of trailing B phred quality scores at the end. N-base calls are treated as zero phred score, and B are quality 2, so by trimming both ends for all scores below 3, these artefacts are removed.
          Does that mean that if we do LEADING:3 TRAILING:3 we only remove those artifacts? So, if we want to remove the bases with a phred score below 34, for example, we should write LEADING:34 TRAILING:34? What is the accepted phred score to keep bases? I noticed that for SLIDINGWINDOW, the parameters are 4:15, but I wondered if 15 was not too low as quality score? Thanks a lot!

          Comment

          • westerman
            Rick Westerman
            • Jun 2008
            • 1104

            #20
            Originally posted by FSeq View Post
            Does that mean that if we do LEADING:3 TRAILING:3 we only remove those artifacts? So, if we want to remove the bases with a phred score below 34, for example, we should write LEADING:34 TRAILING:34? What is the accepted phred score to keep bases? I noticed that for SLIDINGWINDOW, the parameters are 4:15, but I wondered if 15 was not too low as quality score? Thanks a lot!
            It would depend on your application. Trimming, in general, is only required for de novo work -- assembly -- and not for mapping since mapping programs will tend to drop reads or parts of reads that do not match because of poor quality. Even some de novo assembly programs -- Mira comes to mind -- want untrimmed reads.

            With that said, I would lead/trail remove quality 2 or less and slide window at the default 15. That will be a good starting point for most applications -- gets rid of the really bad stuff without knocking out potentially useful bases.

            Comment

            • Gigiux
              Junior Member
              • Nov 2015
              • 4

              #21
              Dear all,
              I am new to NGS and I have the kind of same problem as trimmoME 19/7/15.
              I am applying trimmomatric to trim fastaq files by quality and to remove the adapters. I have two paired files seq1.1.fq and seq1.2.fq with nextera adapters so I ran the following command:
              java -jar trimmomatic-0.33.jar PE -threads 16 -phred64 seq1.1.fq seq1.2.fq pairedOutup1 pairedOutup2 unpairedOutup1 unpairedOutup2 ILLUMINACLIP:NexteraPE-PE.fa:2:30:10:1:true LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36

              The command is executed with the following display:
              Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
              Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
              Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
              Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
              Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
              ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
              Input Read Pairs: 947710 Both Surviving: 0 (0.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 947710 (100.00%)
              TrimmomaticPE: Completed successfully

              However all the output files are completely empty.

              The first lines of the input are:
              {seq1.1.fq}
              @M03595:11:000000000-AG58B:1:1101:16029:1738 1:N:0:26
              ATTGTTAATCGTAAAGCAATGTTCATTCCGATTGTGGCTGTTGCAAGTTTTATGCTTGTAGGTTATGCTGCAACCGATAAAGAAATGCCGGAAATTAGATCTAATCAAATTGAAGTTC
              +
              1>A1AF33DD1AA113B11B1GGE3FGEF00EEAG20AFCGH1A111FGGH2G21FHBGB21FG1F11F1101BB//E//1@100D1@B/////BG111BBG11FE111BG111BFGE
              @M03595:11:000000000-AG58B:1:1101:14217:1754 1:N:0:26
              GTTGGCCATAAGGCTGTTGGTGCGATAGTTAATAATGTGATGGTTCCGATCGATACAAAATTAAATACGGGTGATGTCGTAGAAATCAAGACAAATAAACAGTCACAG
              +
              1AA11@11C1111BF1GG11A0100A00DF22D22D2D22D21BD1B//B///A/A1110BG111F2A///>//FBFFAFA//21BB1111>000B111@10BF1@11
              @M03595:11:000000000-AG58B:1:1101:13810:1764 1:N:0:26
              GTTGAGACTGTGGATGGTATCAGCGGGTATTGCATGAGTGAGTTTATAAAACTCTGTTAG
              +
              ...

              {seq1.2.fq}
              @M03595:11:000000000-AG58B:1:1101:16029:1738 2:N:0:26
              TTACTTCAATTTGTTTATTTCTAATTTCCGGCATTTCTTTATCGGTTGCAGCATAACCTACAAGCATATAACTTGCAACAGCCACAATCGGAATGAACATTGCTTTACGATTAACAAT
              +
              111>>D@31BDF33BB333BAB33DFG3A00A0AFGDGGH2FEA0BE/01110B1111D1A111/0D1222BDG1111B000>0B0/B1////B@11@1BF11GHHFE//FG?1@11B
              @M03595:11:000000000-AG58B:1:1101:14217:1754 2:N:0:26
              CTGTGACTGTTTCTTTGTCTTGATTTCTTCTACTTCACCCGTATTTAATTTTGTTTCTATCGGTTCCTTCACATTATTAACTATCGCTCCAACTGCCTTATGGCCAAC
              +
              1>1>13BB1FDF3BBG3BAFG13DFGAF333333D331AA0B0BFG22DDGH2B0B222DA/////12DA1A2DF1DG22AFDGE//0A>11100@0BD1B11/01/>
              @M03595:11:000000000-AG58B:1:1101:13810:1764 2:N:0:26
              CTAACAGAGTTTTATATTCTCACTCATGCAATACCCGCTGATACCATCCACATTCTCAAC
              +

              What might be the issue? maybe the quality is so low that all the sequences are removed?
              Thank you.

              Comment

              • GenoMax
                Senior Member
                • Feb 2008
                • 7142

                #22
                Have you checked the FastQC profile for these samples? How did they look?

                When something like this happens always start with no or minimal filters/restrictions and see if you get a result. Then start adding filters in afterwards.

                Comment

                • mastal
                  Senior Member
                  • Mar 2009
                  • 666

                  #23
                  I suspect the problem is the -phred64 setting.

                  I think that if you have samples prepared using the Nextera kits, Illumina had switched to -phred33 quality scores by then.

                  Comment

                  • mastal
                    Senior Member
                    • Mar 2009
                    • 666

                    #24
                    Also the order of your output files is incorrect.

                    Trimmomatic will give you the output files in the following order - forward_paired, forward_unpaired, reverse_paired, reverse_unpaired.

                    Comment

                    • kimseonw
                      Junior Member
                      • Oct 2015
                      • 2

                      #25
                      Hello. Would you help me to set options for trimmomatic equivalent to fastq_quality_filter -q 20 -p 75. I like to remove reads with less than 75% of Q20 as well as adapter while maintaining paired end. Thanks much.
                      Last edited by kimseonw; 11-24-2015, 09:57 AM.

                      Comment

                      • mastal
                        Senior Member
                        • Mar 2009
                        • 666

                        #26
                        Have a look at the manual.

                        Comment

                        • kimseonw
                          Junior Member
                          • Oct 2015
                          • 2

                          #27
                          mastal. Sure I do. My understanding is reads containing below certain score can be removed but minimum percentage of certain score may not be removed by Trimmomatic, and I'd like to make sure. Thanks again!

                          Comment

                          • ebustosc
                            Junior Member
                            • Oct 2018
                            • 1

                            #28
                            question

                            Originally posted by westerman View Post
                            ... And I answered my own question about MAXINFO. It is a (newer) parameter that I don't use. However the manual I am looking at says that there are only two numbers associated with MAXINFO: <targetLength>:<strictness> You seem to have three numbers 0 ... 40 ... 0.5. That could be a problem.
                            You could tell me: how did you solve it?
                            I have all three parameters and the manual only talks about two.
                            When I enter the script it leaves me single base sequences

                            Comment

                            Latest Articles

                            Collapse

                            • SEQadmin2
                              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                              by SEQadmin2



                              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                              Despite this, “CRISPR helped turn genome editing from a specialized technique into
                              ...
                              07-31-2026, 11:01 AM
                            • SEQadmin2
                              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                              by SEQadmin2


                              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                              The systematic characterization of the human proteome has
                              ...
                              07-20-2026, 11:48 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, Yesterday, 10:05 AM
                            0 responses
                            8 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 08-13-2026, 12:22 PM
                            0 responses
                            33 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 08-11-2026, 10:35 AM
                            0 responses
                            27 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 08-06-2026, 07:41 AM
                            0 responses
                            38 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...