[westerman]

I don't recognize the 'MAXINFO' parameter. Perhaps that is the problem?

In any case was does your trimLog say? Posting the first 10 lines could be useful.

[westerman]

... And I answered my own question about MAXINFO. It is a (newer) parameter that I don't use. However the manual I am looking at says that there are only two numbers associated with MAXINFO: <targetLength>:<strictness> You seem to have three numbers 0 ... 40 ... 0.5. That could be a problem.

[trimmoMe]

that solved it...
Thanks so much weterman!!

[FSeq]

It's a phred score

Historically, the illumina pipeline occasionally created reads with one (or more rarely two) N base-calls at the start, and more often, a set of trailing B phred quality scores at the end. N-base calls are treated as zero phred score, and B are quality 2, so by trimming both ends for all scores below 3, these artefacts are removed.

Does that mean that if we do LEADING:3 TRAILING:3 we only remove those artifacts? So, if we want to remove the bases with a phred score below 34, for example, we should write LEADING:34 TRAILING:34? What is the accepted phred score to keep bases? I noticed that for SLIDINGWINDOW, the parameters are 4:15, but I wondered if 15 was not too low as quality score? Thanks a lot!

[westerman]

Does that mean that if we do LEADING:3 TRAILING:3 we only remove those artifacts? So, if we want to remove the bases with a phred score below 34, for example, we should write LEADING:34 TRAILING:34? What is the accepted phred score to keep bases? I noticed that for SLIDINGWINDOW, the parameters are 4:15, but I wondered if 15 was not too low as quality score? Thanks a lot!

It would depend on your application. Trimming, in general, is only required for de novo work -- assembly -- and not for mapping since mapping programs will tend to drop reads or parts of reads that do not match because of poor quality. Even some de novo assembly programs -- Mira comes to mind -- want untrimmed reads.

With that said, I would lead/trail remove quality 2 or less and slide window at the default 15. That will be a good starting point for most applications -- gets rid of the really bad stuff without knocking out potentially useful bases.

[Gigiux]

Dear all,
I am new to NGS and I have the kind of same problem as trimmoME 19/7/15.
I am applying trimmomatric to trim fastaq files by quality and to remove the adapters. I have two paired files seq1.1.fq and seq1.2.fq with nextera adapters so I ran the following command:
java -jar trimmomatic-0.33.jar PE -threads 16 -phred64 seq1.1.fq seq1.2.fq pairedOutup1 pairedOutup2 unpairedOutup1 unpairedOutup2 ILLUMINACLIP:NexteraPE-PE.fa:2:30:10:1:true LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36

The command is executed with the following display:
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 947710 Both Surviving: 0 (0.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 947710 (100.00%)
TrimmomaticPE: Completed successfully

However all the output files are completely empty.

The first lines of the input are:
{seq1.1.fq}
@M03595:11:000000000-AG58B:1:1101:16029:1738 1:N:0:26
ATTGTTAATCGTAAAGCAATGTTCATTCCGATTGTGGCTGTTGCAAGTTTTATGCTTGTAGGTTATGCTGCAACCGATAAAGAAATGCCGGAAATTAGATCTAATCAAATTGAAGTTC
+
1>A1AF33DD1AA113B11B1GGE3FGEF00EEAG20AFCGH1A111FGGH2G21FHBGB21FG1F11F1101BB//E//1@100D1@B/////BG111BBG11FE111BG111BFGE
@M03595:11:000000000-AG58B:1:1101:14217:1754 1:N:0:26
GTTGGCCATAAGGCTGTTGGTGCGATAGTTAATAATGTGATGGTTCCGATCGATACAAAATTAAATACGGGTGATGTCGTAGAAATCAAGACAAATAAACAGTCACAG
+
1AA11@11C1111BF1GG11A0100A00DF22D22D2D22D21BD1B//B///A/A1110BG111F2A///>//FBFFAFA//21BB1111>000B111@10BF1@11
@M03595:11:000000000-AG58B:1:1101:13810:1764 1:N:0:26
GTTGAGACTGTGGATGGTATCAGCGGGTATTGCATGAGTGAGTTTATAAAACTCTGTTAG
+
...

{seq1.2.fq}
@M03595:11:000000000-AG58B:1:1101:16029:1738 2:N:0:26
TTACTTCAATTTGTTTATTTCTAATTTCCGGCATTTCTTTATCGGTTGCAGCATAACCTACAAGCATATAACTTGCAACAGCCACAATCGGAATGAACATTGCTTTACGATTAACAAT
+
111>>D@31BDF33BB333BAB33DFG3A00A0AFGDGGH2FEA0BE/01110B1111D1A111/0D1222BDG1111B000>0B0/B1////B@11@1BF11GHHFE//FG?1@11B
@M03595:11:000000000-AG58B:1:1101:14217:1754 2:N:0:26
CTGTGACTGTTTCTTTGTCTTGATTTCTTCTACTTCACCCGTATTTAATTTTGTTTCTATCGGTTCCTTCACATTATTAACTATCGCTCCAACTGCCTTATGGCCAAC
+
1>1>13BB1FDF3BBG3BAFG13DFGAF333333D331AA0B0BFG22DDGH2B0B222DA/////12DA1A2DF1DG22AFDGE//0A>11100@0BD1B11/01/>
@M03595:11:000000000-AG58B:1:1101:13810:1764 2:N:0:26
CTAACAGAGTTTTATATTCTCACTCATGCAATACCCGCTGATACCATCCACATTCTCAAC
+

What might be the issue? maybe the quality is so low that all the sequences are removed?
Thank you.

[GenoMax]

Have you checked the FastQC profile for these samples? How did they look?

When something like this happens always start with no or minimal filters/restrictions and see if you get a result. Then start adding filters in afterwards.

[mastal]

I suspect the problem is the -phred64 setting.

I think that if you have samples prepared using the Nextera kits, Illumina had switched to -phred33 quality scores by then.

[mastal]

Also the order of your output files is incorrect.

Trimmomatic will give you the output files in the following order - forward_paired, forward_unpaired, reverse_paired, reverse_unpaired.

[kimseonw]

Hello. Would you help me to set options for trimmomatic equivalent to fastq_quality_filter -q 20 -p 75. I like to remove reads with less than 75% of Q20 as well as adapter while maintaining paired end. Thanks much.

[mastal]

Have a look at the manual.

http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf

[kimseonw]

mastal. Sure I do. My understanding is reads containing below certain score can be removed but minimum percentage of certain score may not be removed by Trimmomatic, and I'd like to make sure. Thanks again!

[ebustosc]

question

... And I answered my own question about MAXINFO. It is a (newer) parameter that I don't use. However the manual I am looking at says that there are only two numbers associated with MAXINFO: <targetLength>:<strictness> You seem to have three numbers 0 ... 40 ... 0.5. That could be a problem.

You could tell me: how did you solve it?
I have all three parameters and the manual only talks about two.
When I enter the script it leaves me single base sequences