I don't recognize the 'MAXINFO' parameter. Perhaps that is the problem?
In any case was does your trimLog say? Posting the first 10 lines could be useful.
In any case was does your trimLog say? Posting the first 10 lines could be useful.
-
-
... And I answered my own question about MAXINFO. It is a (newer) parameter that I don't use. However the manual I am looking at says that there are only two numbers associated with MAXINFO: <targetLength>:<strictness> You seem to have three numbers 0 ... 40 ... 0.5. That could be a problem.Comment
-
that solved it...
Thanks so much weterman!!Comment
-
Does that mean that if we do LEADING:3 TRAILING:3 we only remove those artifacts? So, if we want to remove the bases with a phred score below 34, for example, we should write LEADING:34 TRAILING:34? What is the accepted phred score to keep bases? I noticed that for SLIDINGWINDOW, the parameters are 4:15, but I wondered if 15 was not too low as quality score? Thanks a lot!Originally posted by tonybolger View PostIt's a phred score
Historically, the illumina pipeline occasionally created reads with one (or more rarely two) N base-calls at the start, and more often, a set of trailing B phred quality scores at the end. N-base calls are treated as zero phred score, and B are quality 2, so by trimming both ends for all scores below 3, these artefacts are removed.Comment
-
It would depend on your application. Trimming, in general, is only required for de novo work -- assembly -- and not for mapping since mapping programs will tend to drop reads or parts of reads that do not match because of poor quality. Even some de novo assembly programs -- Mira comes to mind -- want untrimmed reads.Originally posted by FSeq View Post
With that said, I would lead/trail remove quality 2 or less and slide window at the default 15. That will be a good starting point for most applications -- gets rid of the really bad stuff without knocking out potentially useful bases.Comment
-
Dear all,
I am new to NGS and I have the kind of same problem as trimmoME 19/7/15.
I am applying trimmomatric to trim fastaq files by quality and to remove the adapters. I have two paired files seq1.1.fq and seq1.2.fq with nextera adapters so I ran the following command:
java -jar trimmomatic-0.33.jar PE -threads 16 -phred64 seq1.1.fq seq1.2.fq pairedOutup1 pairedOutup2 unpairedOutup1 unpairedOutup2 ILLUMINACLIP:NexteraPE-PE.fa:2:30:10:1:true LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36
The command is executed with the following display:
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 947710 Both Surviving: 0 (0.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 947710 (100.00%)
TrimmomaticPE: Completed successfully
However all the output files are completely empty.
The first lines of the input are:
{seq1.1.fq}
@M03595:11:000000000-AG58B:1:1101:16029:1738 1:N:0:26
ATTGTTAATCGTAAAGCAATGTTCATTCCGATTGTGGCTGTTGCAAGTTTTATGCTTGTAGGTTATGCTGCAACCGATAAAGAAATGCCGGAAATTAGATCTAATCAAATTGAAGTTC
+
1>A1AF33DD1AA113B11B1GGE3FGEF00EEAG20AFCGH1A111FGGH2G21FHBGB21FG1F11F1101BB//E//1@100D1@B/////BG111BBG11FE111BG111BFGE
@M03595:11:000000000-AG58B:1:1101:14217:1754 1:N:0:26
GTTGGCCATAAGGCTGTTGGTGCGATAGTTAATAATGTGATGGTTCCGATCGATACAAAATTAAATACGGGTGATGTCGTAGAAATCAAGACAAATAAACAGTCACAG
+
1AA11@11C1111BF1GG11A0100A00DF22D22D2D22D21BD1B//B///A/A1110BG111F2A///>//FBFFAFA//21BB1111>000B111@10BF1@11
@M03595:11:000000000-AG58B:1:1101:13810:1764 1:N:0:26
GTTGAGACTGTGGATGGTATCAGCGGGTATTGCATGAGTGAGTTTATAAAACTCTGTTAG
+
...
{seq1.2.fq}
@M03595:11:000000000-AG58B:1:1101:16029:1738 2:N:0:26
TTACTTCAATTTGTTTATTTCTAATTTCCGGCATTTCTTTATCGGTTGCAGCATAACCTACAAGCATATAACTTGCAACAGCCACAATCGGAATGAACATTGCTTTACGATTAACAAT
+
111>>D@31BDF33BB333BAB33DFG3A00A0AFGDGGH2FEA0BE/01110B1111D1A111/0D1222BDG1111B000>0B0/B1////B@11@1BF11GHHFE//FG?1@11B
@M03595:11:000000000-AG58B:1:1101:14217:1754 2:N:0:26
CTGTGACTGTTTCTTTGTCTTGATTTCTTCTACTTCACCCGTATTTAATTTTGTTTCTATCGGTTCCTTCACATTATTAACTATCGCTCCAACTGCCTTATGGCCAAC
+
1>1>13BB1FDF3BBG3BAFG13DFGAF333333D331AA0B0BFG22DDGH2B0B222DA/////12DA1A2DF1DG22AFDGE//0A>11100@0BD1B11/01/>
@M03595:11:000000000-AG58B:1:1101:13810:1764 2:N:0:26
CTAACAGAGTTTTATATTCTCACTCATGCAATACCCGCTGATACCATCCACATTCTCAAC
+
What might be the issue? maybe the quality is so low that all the sequences are removed?
Thank you.Comment
-
Have you checked the FastQC profile for these samples? How did they look?
When something like this happens always start with no or minimal filters/restrictions and see if you get a result. Then start adding filters in afterwards.Comment
-
I suspect the problem is the -phred64 setting.
I think that if you have samples prepared using the Nextera kits, Illumina had switched to -phred33 quality scores by then.Comment
-
Also the order of your output files is incorrect.
Trimmomatic will give you the output files in the following order - forward_paired, forward_unpaired, reverse_paired, reverse_unpaired.Comment
-
Hello. Would you help me to set options for trimmomatic equivalent to fastq_quality_filter -q 20 -p 75. I like to remove reads with less than 75% of Q20 as well as adapter while maintaining paired end. Thanks much.Last edited by kimseonw; 11-24-2015, 09:57 AM.Comment
-
Have a look at the manual.
Comment
-
mastal. Sure I do. My understanding is reads containing below certain score can be removed but minimum percentage of certain score may not be removed by Trimmomatic, and I'd like to make sure. Thanks again!Comment
-
question
You could tell me: how did you solve it?Originally posted by westerman View Post
I have all three parameters and the manual only talks about two.
When I enter the script it leaves me single base sequences
Comment
-
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment