Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • cshowell
    Junior Member
    • Apr 2012
    • 9

    #1

    Problem running BWA sampe

    Maybe someone can see what I'm doing wrong here. I'm using BWA to align a dataset and get a SAM file that I can use for variant calling. I've indexed the reference fasta file with 'bwa index' and run 'bwa aln' to generate my .sai files. These steps seem to have worked, but when I try to use 'bwa sampe' to produce a .sam file, the process aborts and I get the following error message:

    '[bns_restore_core] fail to open file 'human_g1k_v37.fasta.ann'. Abort!'

    The command I'm using is:

    'bwa sampe -a 500 -o 100000 -n 3 -N 10 -P human_g1k_v37.fasta ERR035484_1.sai ERR035484_2.sai ERR035484_1.fastq ERR035484_2.fastq > PEA1.sam'

    I have a .ann file ('human_g1k_v37.ann') from the indexing step, and I thought it might be a filename problem, i.e. the program trying to open a .fasta.ann file instead of just .ann, but omitting the .fasta in the command still gave a similar error message.

    The first few lines of my .ann file look like this:

    3101804739 84 11
    0 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
    0 249250621 39
    0 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
    249250621 243199373 24
    0 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
    492449994 198022430 9
    0 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
    690472424 191154276 12
    0 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1

    I've searched the forum but not found a solution to this that works for me. Can anyone help me out?
  • Rocketknight
    Member
    • Sep 2011
    • 86

    #2
    The indexing step should have generated the file human_g1k_v37.fasta.ann instead of human_g1k_v37.ann . Renaming it to human_g1k_v37.fasta.ann (and doing the same for any of the other index files that are mysteriously misnamed) should fix the problem.

    Comment

    • cshowell
      Junior Member
      • Apr 2012
      • 9

      #3
      Thanks Rocketnight, but I still get the error:

      [bam_header_read] invalid BAM binary header (this is not a BAM file).
      [bam_header_read] invalid BAM binary header (this is not a BAM file).
      [bns_restore_core] fail to open file 'human_g1k_v37.fasta.nt.ann'. Abort!

      The reads are from an Illumina GAIIx, so everything should be base space, and from what I've read, the '.nt' refers to colour space data.

      My alignment command was 'bwa aln -n 3 -o 1 -e -1 -d 16 -l 5 -k 2 - l 14 -t1 -M 3 -O 11 -E 4 -q 0' if that's any help. I'm using bwa/0.6.1.

      Any more suggestions would be greatly appreciated.

      Comment

      • Rocketknight
        Member
        • Sep 2011
        • 86

        #4
        Most of those command-line options are unneccessary - you're just setting values to their default values, which doesn't change much. Those options are only there to be tinkered with if you really know what you're doing, so the only thing you really need to run bwa aln is:

        $ bwa aln [genome.fasta] [reads.fq] > [output.sai]

        Secondly, bwa seems to be freaking out attempting to read a BAM file. Are you supplying reads in FASTQ format [.fastq(.gz) or .fq(.gz)] or .BAM format?

        Comment

        • cshowell
          Junior Member
          • Apr 2012
          • 9

          #5
          The reads going into BWA are in fastq format, converted from the Sequence Read Archive's .sra format using the SRA Toolkit. I was puzzled by the BAM error too, but I can't see anything in what I've done so far that would lead it to expect a BAM file.

          Comment

          • cshowell
            Junior Member
            • Apr 2012
            • 9

            #6
            Bump for any more input on what might be stopping bwa sampe from running. Any ideas?

            Why would BWA suddenly expect to see a BAM file when everything was supplied in fastq?

            Comment

            • Rocketknight
              Member
              • Sep 2011
              • 86

              #7
              Can you give me the first few lines of the FASTQ input file? (If it's gzipped, use gunzip -c [file] | head -n 8)

              Comment

              • cshowell
                Junior Member
                • Apr 2012
                • 9

                #8
                Originally posted by Rocketknight View Post
                Can you give me the first few lines of the FASTQ input file? (If it's gzipped, use gunzip -c [file] | head -n 8)
                The first 8 lines are:

                @ERR035484.1 CRIRUN_408:3:9:10903:5069 length=72
                CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTACCCCTAACCCTAACCGCACCC
                +ERR035484.1 CRIRUN_408:3:9:10903:5069 length=72
                ;B;CD2@F??=BBCCFEFFFC?E4FF<FBFFG>AFDA9D>F::E@E9B2;>0?###################
                @ERR035484.2 CRIRUN_408:3:40:4508:13433 length=72
                CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC
                +ERR035484.2 CRIRUN_408:3:40:4508:13433 length=72
                BB@GHIIHFHIIIIDHIIIIEGIIIICIIIIIGIIIIIFIIIIIHIIIGFEEIIIBEGIEEGEBEAD@>?;A

                Thanks for continuing to try to help, Rocketknight, it's appreciated.

                Comment

                • cshowell
                  Junior Member
                  • Apr 2012
                  • 9

                  #9
                  Also, the first few lines of the fasta reference file are:

                  >1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                  (The N's give way to actual sequence soon after this.)

                  Comment

                  • Rocketknight
                    Member
                    • Sep 2011
                    • 86

                    #10
                    That looks fine, I can't see BWA mistaking it for a BAM file or anything. BWA is a relatively straightforward program, so I've no idea what could be causing this. All I can think of at this point is a complete clean run with the absolute minimum of command line options, in case some upstream step went wrong somehow.

                    Remove all the indexes and .sai files you've created. The only files you should have left are your two FASTQ read files and the lone FASTA genome file (they can be gzipped, it makes no difference). Index the genome by cding to the directory it's in and just typing "bwa index [genome file]". Align the two FASTQ files with "bwa aln [genome file] [fastq file] > [output file]", then do "bwa sampe [genome file] [sai file 1] [sai file 2] [fastq file 1] [fastq file 2] > [output.sam]". Don't add any other command line options. Paste the output from each step into a text file and post it up here when you're done (there shouldn't be any sensitive information in it).

                    With any luck it should either work outright, or at least create an error that'll give me some idea of what's going wrong.

                    Comment

                    • swbarnes2
                      Senior Member
                      • May 2008
                      • 910

                      #11
                      Is that a space in the chromosome name of the fasta? That might be causing problems.

                      Comment

                      • cshowell
                        Junior Member
                        • Apr 2012
                        • 9

                        #12
                        I'm still getting the same problem after re-running the index and align steps. The error message (exit code 134) gave the following as the output:

                        [bam_header_read] invalid BAM binary header (this is not a BAM file).
                        [bam_header_read] invalid BAM binary header (this is not a BAM file).
                        [bns_restore_core] fail to open file 'human_g1k_v37.fasta.nt.ann'. Abort!
                        /netscr/lsf/killdevil/lsbatch/1334055583.424139: line 8: 15693 Aborted (core dumped) bwa sampe human_g1k_v37.fasta ERR035484_1.sai ERR035484_2.sai ERR035484_1.fastq ERR035484_2.fastq

                        The alignment files were produced with the proper filenames/extensions (e.g. human_g1k_v37.fasta.ann). It still seems to think it's looking for a BAM file.

                        Any thoughts? I'm thinking of maybe trying a different reference sequence, but I don't really have a reason to suspect a problem with the one from 1000 Genomes.

                        swbarnes2 - I only see two spaces in the description line. Which one do you think might cause a problem? I can get rid of it with a Perl script if necessary.

                        Comment

                        • ulz_peter
                          Senior Member
                          • Feb 2010
                          • 219

                          #13
                          I was able to reproduce your error: I just put in a wrong prefix index and wrong sai files. It seems bwa uses sam bam_reader functions to read the native .sai format (that's why the error appears twice). So: Do the indexing again using the -p (for Prefix) option and use this prefix (exactly this prefix) for the aln and sampe commands.

                          And probably there is something wrong with the .sai files (that may be because of the prefix issue). Did you change bwa versions between alignment and sampe step?

                          Hope that helps,
                          Peter

                          Comment

                          • cshowell
                            Junior Member
                            • Apr 2012
                            • 9

                            #14
                            Ok. I've tried repeating the index and alignment steps and I think Peter is right about there being a problem with the .sai files. The alignment step reports that it runs successfully but, when I check the contents of the .sai files, they seem to contain only details about the lsf job queueing e.g. 'Job <533216> is submitted to queue <day>'. What could be causing this? I've been over everything I can think of, and repeated the steps multiple times (even trying earlier versions of BWA, but not mixing versions). Any more ideas after seeing the .sai output?

                            Comment

                            • lh3
                              Senior Member
                              • Feb 2008
                              • 686

                              #15
                              use option -f

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                New Genomics Technologies Take Aim at Long-Standing Limits
                                by SEQadmin2


                                Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                                We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                                ...
                                Yesterday, 10:25 AM
                              • SEQadmin2
                                How Immunogenomics Decodes Immunity’s Genetic Blueprint
                                by SEQadmin2




                                The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                                This convergence of genetics, immunology, and computation...
                                09-01-2026, 05:41 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Today, 09:51 AM
                              0 responses
                              7 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 09-25-2026, 09:06 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 09-23-2026, 11:05 AM
                              0 responses
                              26 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 09-18-2026, 11:37 AM
                              1 response
                              46 views
                              0 reactions
                              Last Post pekgio
                              by pekgio
                               
                              Working...