Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • a quick question about SV type in pindel?

    just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
    couldn't find any clue from pindel website.

    Thank you

  • #2
    I think that's when there are multiple successive bases that are changed, ie, if the reference sequence is:

    AGCGAG,TGAT,GAC

    Then the variant sequence could be

    AGCGAG,CTA,GAC

    At least that's what I remember thinking it was long ago; if that makes no sense then let me know as I could be mistaken for sure.

    Comment


    • #3
      Hi, Thanks a lot for your reply. I ran pindel and was got confused by the first SV output marked with RPL - e.g.

      line306 frameshift substitution KIAA1751:NM_001080484:exon18:c.2194_2215CCAAGCCAGGGTGGGCGGGG, chr1 1887091 1887112 CGCCCGCCCACCCTGGCTTGGC CCCCGCCCACCCTGGCTTGG

      If we align the 2 sequences (ref and alt), apparently it results from a G-deleteion at the 2nd base from the reference sequence. but pindel said it is a RPL

      I ran GATK, which also reported this SV but correctly identified this SV as 'deletion' -
      line253 frameshift deletion KIAA1751:NM_001080484:exon18:c.2214delC.G738fs, chr1 1887092 1887092 G

      I am just not sure if this is because of what I've missed in RPL definition, or because the program was confused by the alignment.

      Comment


      • #4
        Then perhaps I'm a bit confused. The Pindel authors are nice/quick with responses to email inquiries; I'd just email the contact author if I were you.

        Comment


        • #5
          Thank you, Heisman. I just emailed the author, and will update you if there is any response.

          Comment


          • #6
            About svtype in vcf file

            Originally posted by caswater View Post
            just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
            couldn't find any clue from pindel website.

            Thank you
            Dear everyone,
            I recently was doing something about genome-wide polymorphism detection, and one of my colleague recommended me to use pindel to get structure variation of re-seq data against reference genome. Here is my question: what does the SVTYPE=RPL in the vcf file stand for?
            Your answer will be useful to me. Thank you!

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Current Approaches to Protein Sequencing
              by seqadmin


              Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
              04-04-2024, 04:25 PM
            • seqadmin
              Strategies for Sequencing Challenging Samples
              by seqadmin


              Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
              03-22-2024, 06:39 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, 04-11-2024, 12:08 PM
            0 responses
            21 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 04-10-2024, 10:19 PM
            0 responses
            23 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 04-10-2024, 09:21 AM
            0 responses
            18 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 04-04-2024, 09:00 AM
            0 responses
            49 views
            0 likes
            Last Post seqadmin  
            Working...
            X