Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • sandmann
    Junior Member
    • May 2009
    • 3

    #1

    Eland2 alignment format

    Hi everyone,

    I have received data in "eland2" format, generated with eland's "--multi" option. Unfortunately, I couldn't find any explanation of the different fields. (As we don't have an Illumina sequencer ourselves, I don't have access to the original documentation.)

    Maybe one of you can explain the following lines to me ? I am especially puzzled by the numbers, e.g. 4:3:3 and the "R1" at end of the line.

    Thanks a lot !

    s2.25mer.txt-6 AAAGGTGGTAGTAAAAACTCCAGCC 0:1:0 chr8.fa:126358637R1
    s2.25mer.txt-7 ATTTAGAACCTACCCCATATCCAGA 0:1:0 chr7.fa:88923181R1
    s2.25mer.txt-8 ACTAAGGCCCCATCTGTATTAGGGT 1:0:0 chr10.fa:18303270F0
    s2.25mer.txt-9 ATCGCGGCGAGGTGACGTTCCAGGT 4:3:3 chr10.fa:43176100F1,127985313F0,chr12.fa:81881255F1,chr13.fa:112383612F0,chr14.fa:106081269R1,chr15.fa:27988434F0,chr9.fa:24905725F0
    s2.25mer.txt-10 ATCCACTTCCCTCTGGCCACTTATG 10:5:1 chr12.fa:4789768F0,chr13.fa:67190512F0,113384484R0,chr14.fa:75118244F1,chr15.fa:98762552R0,98781004R0,98867883F0,chr17.fa:5111297R1,30315212F1,chr18.fa:82508645F1,chr2.fa:151285482F0,chr3.fa:50174369F0,chr6.fa:67684783R1,chr9.fa:31743570R0,90992775F0
  • simonandrews
    Simon Andrews
    • May 2009
    • 870

    #2
    The fields in the eland_multi output are:

    1) Sequence Name

    2) Sequence

    3) NM (No match) QC (QC failure) RM (Repeat Masked) or x:y:z (where x,y, and z are the number of exact, single error and two error matches found)

    4) Match list in form:

    seqname1.txt:100R1, 200F2, seqname2.txt:300R2

    Which would be two matches in seqname1.txt, one reverse match at pos 100 with 1 mismatch. One forward match at position 200 with 2 mismatches. One match on seqname2.txt reverse at pos 300 with 2 mismatches.

    Not the nicest format to have to work with...

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Today, 10:35 AM
    0 responses
    4 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    41 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    47 views
    0 reactions
    Last Post SEQadmin2  
    Working...