Eland2 alignment format

[sandmann]

Hi everyone,

I have received data in "eland2" format, generated with eland's "--multi" option. Unfortunately, I couldn't find any explanation of the different fields. (As we don't have an Illumina sequencer ourselves, I don't have access to the original documentation.)

Maybe one of you can explain the following lines to me ? I am especially puzzled by the numbers, e.g. 4:3:3 and the "R1" at end of the line.

Thanks a lot !

s2.25mer.txt-6 AAAGGTGGTAGTAAAAACTCCAGCC 0:1:0 chr8.fa:126358637R1
s2.25mer.txt-7 ATTTAGAACCTACCCCATATCCAGA 0:1:0 chr7.fa:88923181R1
s2.25mer.txt-8 ACTAAGGCCCCATCTGTATTAGGGT 1:0:0 chr10.fa:18303270F0
s2.25mer.txt-9 ATCGCGGCGAGGTGACGTTCCAGGT 4:3:3 chr10.fa:43176100F1,127985313F0,chr12.fa:81881255F1,chr13.fa:112383612F0,chr14.fa:106081269R1,chr15.fa:27988434F0,chr9.fa:24905725F0
s2.25mer.txt-10 ATCCACTTCCCTCTGGCCACTTATG 10:5:1 chr12.fa:4789768F0,chr13.fa:67190512F0,113384484R0,chr14.fa:75118244F1,chr15.fa:98762552R0,98781004R0,98867883F0,chr17.fa:5111297R1,30315212F1,chr18.fa:82508645F1,chr2.fa:151285482F0,chr3.fa:50174369F0,chr6.fa:67684783R1,chr9.fa:31743570R0,90992775F0

[simonandrews]

The fields in the eland_multi output are:

1) Sequence Name

2) Sequence

3) NM (No match) QC (QC failure) RM (Repeat Masked) or x:y:z (where x,y, and z are the number of exact, single error and two error matches found)

4) Match list in form:

seqname1.txt:100R1, 200F2, seqname2.txt:300R2

Which would be two matches in seqname1.txt, one reverse match at pos 100 with 1 mismatch. One forward match at position 200 with 2 mismatches. One match on seqname2.txt reverse at pos 300 with 2 mismatches.

Not the nicest format to have to work with...