Hi,
I am a complete newbie, so please bear with me if my question seems too silly.
I recently downloaded a RNAseq dataset from GEO, it contains paired data files, and in the following format:
readID Seq 0-mi**** 1-mi**** 2-mi**** chr start end strand
HWUSI-EAS230-R:2:99:1151:1802#0/1 GAGCTCATTGGTGGCGTGGTGGCCTTGACCTTCCGG 1 0 0 chr10 70914936 70914971 -
HWUSI-EAS230-R:2:44:642:495#0/1 TTGGCTGCCTTCTGGGGTGAACTTTCTGCTATTTCC 0 0 1 chr7 47298110 47298145 -
......
I googled around but could not figure out what format it is, and how to proceed to analyze. My goal is to produce gene expression values (RPKM) from these data files.
Thanks so much for your help.
I am a complete newbie, so please bear with me if my question seems too silly.
I recently downloaded a RNAseq dataset from GEO, it contains paired data files, and in the following format:
readID Seq 0-mi**** 1-mi**** 2-mi**** chr start end strand
HWUSI-EAS230-R:2:99:1151:1802#0/1 GAGCTCATTGGTGGCGTGGTGGCCTTGACCTTCCGG 1 0 0 chr10 70914936 70914971 -
HWUSI-EAS230-R:2:44:642:495#0/1 TTGGCTGCCTTCTGGGGTGAACTTTCTGCTATTTCC 0 0 1 chr7 47298110 47298145 -
......
I googled around but could not figure out what format it is, and how to proceed to analyze. My goal is to produce gene expression values (RPKM) from these data files.
Thanks so much for your help.
Comment