Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • data format and how to analysis

    Hi,

    I am a complete newbie, so please bear with me if my question seems too silly.

    I recently downloaded a RNAseq dataset from GEO, it contains paired data files, and in the following format:

    readID Seq 0-mi**** 1-mi**** 2-mi**** chr start end strand
    HWUSI-EAS230-R:2:99:1151:1802#0/1 GAGCTCATTGGTGGCGTGGTGGCCTTGACCTTCCGG 1 0 0 chr10 70914936 70914971 -
    HWUSI-EAS230-R:2:44:642:495#0/1 TTGGCTGCCTTCTGGGGTGAACTTTCTGCTATTTCC 0 0 1 chr7 47298110 47298145 -

    ......

    I googled around but could not figure out what format it is, and how to proceed to analyze. My goal is to produce gene expression values (RPKM) from these data files.

    Thanks so much for your help.

  • #2
    It'd help if you mentioned the GEO accession number. They probably mention more about the format in the GEO entry. If nothing else, you could probably convert that to SAM/BAM format (the difficulty being whether or not the mappings are actually unique) and then calculate the RPKM. Alternatively, if they provide no further information (or the original fastq file), you could convert that to a multi-fasta file and then realign it.

    Comment


    • #3
      Hi, Thanks a lot for your response. The dataset is GSE22260. I do not see any mentioning about the data formet, but maybe it is only because I do not know where to look. Could you also advise how to convert what I have to SAM/BAM format? or how to convert to multi-fasta files? I am fairly familiar with R, so I am hoping I will be able figure the later analysis after I have data in BAM format. Thanks again.

      Comment


      • #4
        I believe that these are output from "Illumina Genome Analyzer Pipeline". I am not sure if there is a converter from this format to SAM/BAM. Multi-fastA would be trivial. Something like:

        cut -f 1,2 file.name | sed -e 's/^/>/' -e 's/\t/\n' > output.file

        or

        perl -nale 'print ">$F[0]\n$F[1]"' file.name > output.file

        Then you could map the reads against a current human genome and go from there.

        Comment


        • #5
          Thank, Rick. I am trying to avoid doing alignment myself. Since each sequence comes with chromosome number and genomic coordinates in the data file, I assume they are already aligned (?). Is there any tool that I can use to convert the data into some format so that I can read them into some R packages, such as ShortRead or others (?), for further analysis?

          Comment


          • #6
            As Rick suggested and they state in the data processing section of each sample, the files are from the Genome Analyzer Pipeline (there are two files for each sample, since this is paired-end data). If you were willing to redo the alignment, you can download the reads from SRA and convert them to fastq with fastq-dump. Alternatively, it wouldn't be difficult to write a small program in perl/python/R/whatever to read in both read files at once and output to SAM. Just make sure that corresponding lines in each file are actually meant to go together (that is, ensure that read names match), as if they kept reads where only one end maps then you would otherwise get really screwy results. So, just put a * in the base quality field and make up an appropriate fake MAPQ value along with the correct flag and you're good to go.

            Comment


            • #7
              @bostonian

              I do not use ShortRead however reading the manual ShortRead uses the readAligned part of bioconductor. I am not sure that readAligned will read in your file directly however the fields are similar and I suspect that with some simple data manipulation you could get them read in.


              BTW: It is this type of data manipulation that makes bioinformatics such a joy. :-)

              Comment


              • #8
                @bostonian

                I am currently struggling with the same issue, did you find a solution for your problem?

                Comment

                Latest Articles

                Collapse

                • seqadmin
                  Strategies for Sequencing Challenging Samples
                  by seqadmin


                  Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                  03-22-2024, 06:39 AM
                • seqadmin
                  Techniques and Challenges in Conservation Genomics
                  by seqadmin



                  The field of conservation genomics centers on applying genomics technologies in support of conservation efforts and the preservation of biodiversity. This article features interviews with two researchers who showcase their innovative work and highlight the current state and future of conservation genomics.

                  Avian Conservation
                  Matthew DeSaix, a recent doctoral graduate from Kristen Ruegg’s lab at The University of Colorado, shared that most of his research...
                  03-08-2024, 10:41 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by seqadmin, 03-27-2024, 06:37 PM
                0 responses
                13 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 03-27-2024, 06:07 PM
                0 responses
                12 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 03-22-2024, 10:03 AM
                0 responses
                53 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 03-21-2024, 07:32 AM
                0 responses
                69 views
                0 likes
                Last Post seqadmin  
                Working...
                X