samtools faidx Segmentation fault

[baohua100]

populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.
Segmentation fault

What's the meaning of defferent line length ?

It's the standard fasta file.

I download it from:
ftp://ftp.jgi-psf.org/pub/JGI_data/P...asked.fasta.gz

[nilshomer]

populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.
Segmentation fault

What's the meaning of defferent line length ?

It's the standard fasta file.

I download it from:
ftp://ftp.jgi-psf.org/pub/JGI_data/P...asked.fasta.gz

Can you verify that every sequence line in the FASTA has the same length?

[webbrewer]

I am having this same issue. While I have verified that there are lines of different length in the sequence file, however, why should this matter?

[webbrewer]

This bioperl snippet fixes the fasta:

use Bio::SeqIO;
$in  = Bio::SeqIO->new(-file => "inputfilename",
                       -format => 'Fasta');
$out = Bio::SeqIO->new(-file => ">outputfilename",
                       -format => 'Fasta');
while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }

[totalnew]

I had this problem too, my solution was to use unix command to trim and fold the fasta file. You would have to cut the header first, and catenate it with your sorted fasta file. It perfectly solves the problem.

Writing a shell script may be a good idea to make things easlier.

[maubp]

populus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.
Segmentation fault

What's the meaning of defferent line length ?

I just found the same thing when there are blank lines in the FASTA file. The message "different line length" is very misleading in this case. I'll report this bug.

[lindseyjane]

Thanks very much webbrewer for your bioperl fix, it worked perfectly.

[maubp]

This bioperl snippet fixes the fasta

Just for anyone interested here is the Biopython equivalent:

from Bio import SeqIO
SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")

The convert function returns the number of records if you wanted that information.

[shinout]

I faced the same problem, but solved with webbrewer's code!

This bioperl snippet fixes the fasta:

use Bio::SeqIO;
$in  = Bio::SeqIO->new(-file => "inputfilename",
                       -format => 'Fasta');
$out = Bio::SeqIO->new(-file => ">outputfilename",
                       -format => 'Fasta');
while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }

Thanks a lot!

[ardmore]

Hello, I have the same problem. I found the last lines in fa file likes:

ggttagggtgtggtgtgtgggtgtgtgtgggtgtggtgtgtgtgggtgtg
gtgtgtgggtgtgggtgtgggtgtgggtgtgtgggtgtggtgtgtgggtg
tggT

That means the last line has not the same length with others.
My question is that can I manually modify instead of using a software.
I don't want to install too many software because of rare usage.

Thanks.

[michmich]

The problem is that your FASTA file has a blank lines in it.
you need to get rid of them!!!

you can :g/^$/d in vi/vim editor.

[jdjax]

The problem is that your FASTA file has a blank lines in it.
you need to get rid of them!!!

you can :g/^$/d in vi/vim editor.

Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

I then looked at my fasta file in vim and it does not have any blank lines in the file.

Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

Thank you in advance for your help.

[jdjax]

Hello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.

I then looked at my fasta file in vim and it does not have any blank lines in the file.

Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?

Thank you in advance for your help.

Figured it out on my own.

[maubp]

Figured it out on my own.

For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.

[jdjax]

For the benefit of future readers, what was it about your FASTA file that faidx was breaking on? You said it wasn't blank lines.

It actually was blank lines. There were two blank lines at the end of my file that caused the problem.