reads position in reference sequence(sam file)

[me91]

Hi all,

there are some reads aligned. the .sam output file produced using bowtie, is like bellow and i want to extract aligned reads and their mapped positions on reference cromosome. I have read similar threads and found a sra format description but there are some differences! i need the position in reference sequence where each read has mapped.

@HD VN:1.0 SO:unsorted
@SQ SN:gi|224384765|gb|CM000666.1| LN:191154276
@PG ID:Bowtie VN:0.12.8 CL:"bowtie -q -n 3 -e 100 -l 50 -y -S -p 8 D:\a\index\ch4indexed D:\a\SRR017963.fastq D:\a\output_file.sam"
SRR017963.1 HWI-EAS153_5_30KE6AAXX:2:1:105:2042 length=76 4 * 0 0 * * 0 0 GTNNNTTNTTCTTGTGNTTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTA :6!!!::!::::::::!:::::::::::::7777711131311331131111/13111101013/0/0111111/0 XM:i:0
SRR017963.3 HWI-EAS153_5_30KE6AAXX:2:1:194:1662 length=76 4 * 0 0 * * 0 0 GAATGCAATCATCATCGCACAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCG :7:21::60:71-1:--&:0:4440(3::310372&*/.2'-66/3+023/.,226-3323+2'02.,262323,2 XM:i:0


thanks for any advice.

[kmcarr]

Hi all,

there are some reads aligned. the .sam output file produced using bowtie, is like bellow and i want to extract aligned reads and their mapped positions on reference cromosome. I have read similar threads and found a sra format description but there are some differences! i need the position in reference sequence where each read has mapped.

@HD	VN:1.0	SO:unsorted
@SQ	SN:gi|224384765|gb|CM000666.1|	LN:191154276
@PG	ID:Bowtie	VN:0.12.8	CL:"bowtie -q -n 3 -e 100 -l 50 -y -S -p 8 D:\a\index\ch4indexed D:\a\SRR017963.fastq D:\a\output_file.sam"
SRR017963.1 HWI-EAS153_5_30KE6AAXX:2:1:105:2042 length=76	4	*	0	0	*	*	0	0	GTNNNTTNTTCTTGTGNTTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTA	:6!!!::!::::::::!:::::::::::::7777711131311331131111/13111101013/0/0111111/0	XM:i:0
SRR017963.3 HWI-EAS153_5_30KE6AAXX:2:1:194:1662 length=76	4	*	0	0	*	*	0	0	GAATGCAATCATCATCGCACAGAATCGAATGGAATCATCGAATGGACTCGAATGGAATAATCATTGAACGGAATCG	:7:21::60:71-1:--&:0:4440(3::310372&*/.2'-66/3+023/.,226-3323+2'02.,262323,2	XM:i:0

thanks for any advice.

[Suggestion: when posting long lines of formatted text wrap them in [CODE] tags as I have done with your SAM lines so they will be readable. (Highlight the text you want to format as CODE then click on the hashtag (#) symbol in the formatting bar at the top of the message editor window.)]

Read the SAM (not SRA) format specification: LMGTFY

The two example lines you showed don't have a chromosomal position because they are unmapped.

[me91]

Read the SAM (not SRA) format specification: LMGTFY

As i said i have read that. but it was explained that Each alignment line has 11 mandatory fields and the 4th field is 1-based leftmost mapping position. but this field is 4 in all my aligned reads!

[kmcarr]

As i said i have read that. but it was explained that Each alignment line has 11 mandatory fields and the 4th field is 1-based leftmost mapping position. but this field is 4 in all my aligned reads!

The fourth field in your line is empty. Fields are separated by tabs; the first field (QNAME or query name) includes the entirety of:

"SRR017963.1 HWI-EAS153_5_30KE6AAXX:2:1:105:2042 length=76"

SRR017963.1 and 'length-76' is separated by the rest of the ID by a spaces.

The second field, the FLAG field is '4' which indicates that this was an unpaired read and that it is unmapped. The fourth field is '0' because it's unmapped. The third field (the RNAME or reference name) is '*' because the read is unmapped.

[me91]

I was wrong counting fields. thank you ...