Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • sparsai
    Junior Member
    • Sep 2012
    • 3

    Makeblastdb errors

    Hi All,

    I'm trying to make a blast database, but I'm not sure what type of file I have. What I'm trying to do is take the R1 and R2 files from RNA-seq and create a database. When I make my database can these two files be put together into one database or will I have to make a separate database for each file? Right now I'm just doing one file at a time.

    Here is an example of the command I'm using:
    makeblastdb -in SM1_no_dups_R1.q -dbtype 'nucl' -out SM1R1db

    The error:
    BLAST options error: SM1_no_dups_R1.q does not match input format type, default input type is FASTA

    Here's part of my file:
    @D3NH4HQ1:107:C0LN7ACXX:1:1101:1423:2144 1:N:0:ATCACG
    CGGCTTCAGACATTTTGGGTCTTCCTTACTAGCAACACATTTTTGTGCAAGGTCTGTGACATCTTTTACCATTTTAGCTGCTTCTTCATAAGTGCTTT
    +
    CCFFFFFHHGHHJJJJHIJHHHIIJJJIJJJJJJJJJJDIJJJJJHIIJJJJGHIJJJIJIJJJJJJHHHHHHF@DFFFEEEEEEEDDEECCFDDEDD
    @D3NH4HQ1:107:C0LN7ACXX:1:1101:1418:2180 1:N:0:ATCACG
    CTGGTTGCAAATAGACTGGTTCTTATGGGCAAGAACAAAAAGAGTGTGATATGGTCCAACTGAGCCATACAGTATTTCCAGACTTCAACAGGTCAATC
    +
    @@DDDDDAFHFH@<?EEFG@9?FEEHHIGFBEBEDFHFGBB@7?9BGFEHGII@BB)=CG@GGGADEAGHHFC??7>C?BDDECCCCCCCAAACCCDC
    @D3NH4HQ1:107:C0LN7ACXX:1:1101:1835:2135 1:N:0:ATCACG
    GCATGTCTGATGAAGTGGGTCTTCACCCACCAAAGGTTATGCTCCAATATATCTGCTAGTCTATAAGGTGCCACAAGATTCTTTGCTGCTCTTGCAGA
    +

    Thank you!
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    You have a FASTQ format file, which is the standard for NGS data. makeBlastdb on the other hand expects FASTA file as default input.

    Is there a reason you are trying to use blast for the searches instead of using a NGS aligner (like bwa, bowtie, STAR etc)?

    Comment

    • sparsai
      Junior Member
      • Sep 2012
      • 3

      #3
      Right, that makes sense. The goal is to create this database and use a query file of genes to search for genes. I'm fairly new to this whole area so I'm not even sure what my best options are. I was advised to create a database with these read files, but not how I can go about doing that.

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Before you go too far into this you may want to peruse this document: http://en.wikibooks.org/wiki/Next_Ge...cing_%28NGS%29

        Start with the preprocessing/alignment sections.

        Comment

        • sparsai
          Junior Member
          • Sep 2012
          • 3

          #5
          This definitely looks like something I need! Thank you and hopefully soon I will be able to ask more informed questions.

          Comment

          Latest Articles

          Collapse

          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM
          • SEQadmin2
            Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by SEQadmin2


            I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

            Here are nine questions we think about, in roughly the order they matter, before...
            06-18-2026, 07:11 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          22 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-30-2026, 05:37 AM
          0 responses
          23 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-26-2026, 11:10 AM
          0 responses
          22 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-17-2026, 06:09 AM
          0 responses
          55 views
          0 reactions
          Last Post SEQadmin2  
          Working...