Makeblastdb errors

[sparsai]

Hi All,

I'm trying to make a blast database, but I'm not sure what type of file I have. What I'm trying to do is take the R1 and R2 files from RNA-seq and create a database. When I make my database can these two files be put together into one database or will I have to make a separate database for each file? Right now I'm just doing one file at a time.

Here is an example of the command I'm using:
makeblastdb -in SM1_no_dups_R1.q -dbtype 'nucl' -out SM1R1db

The error:
BLAST options error: SM1_no_dups_R1.q does not match input format type, default input type is FASTA

Here's part of my file:
@D3NH4HQ1:107:C0LN7ACXX:1:1101:1423:2144 1:N:0:ATCACG
CGGCTTCAGACATTTTGGGTCTTCCTTACTAGCAACACATTTTTGTGCAAGGTCTGTGACATCTTTTACCATTTTAGCTGCTTCTTCATAAGTGCTTT
+
CCFFFFFHHGHHJJJJHIJHHHIIJJJIJJJJJJJJJJDIJJJJJHIIJJJJGHIJJJIJIJJJJJJHHHHHHF@DFFFEEEEEEEDDEECCFDDEDD
@D3NH4HQ1:107:C0LN7ACXX:1:1101:1418:2180 1:N:0:ATCACG
CTGGTTGCAAATAGACTGGTTCTTATGGGCAAGAACAAAAAGAGTGTGATATGGTCCAACTGAGCCATACAGTATTTCCAGACTTCAACAGGTCAATC
+
@@DDDDDAFHFH@<?EEFG@9?FEEHHIGFBEBEDFHFGBB@7?9BGFEHGII@BB)=CG@GGGADEAGHHFC??7>C?BDDECCCCCCCAAACCCDC
@D3NH4HQ1:107:C0LN7ACXX:1:1101:1835:2135 1:N:0:ATCACG
GCATGTCTGATGAAGTGGGTCTTCACCCACCAAAGGTTATGCTCCAATATATCTGCTAGTCTATAAGGTGCCACAAGATTCTTTGCTGCTCTTGCAGA
+

Thank you!

[GenoMax]

You have a FASTQ format file, which is the standard for NGS data. makeBlastdb on the other hand expects FASTA file as default input.

Is there a reason you are trying to use blast for the searches instead of using a NGS aligner (like bwa, bowtie, STAR etc)?

[sparsai]

Right, that makes sense. The goal is to create this database and use a query file of genes to search for genes. I'm fairly new to this whole area so I'm not even sure what my best options are. I was advised to create a database with these read files, but not how I can go about doing that.

[GenoMax]

Before you go too far into this you may want to peruse this document: http://en.wikibooks.org/wiki/Next_Ge...cing_%28NGS%29

Start with the preprocessing/alignment sections.

[sparsai]

This definitely looks like something I need! Thank you and hopefully soon I will be able to ask more informed questions.