Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • PatB
    Junior Member
    • Feb 2013
    • 3

    #1

    miRDeep-p "problem in read format"

    Hi!!

    I am using miRDeep-p since 1 week and everything was OK until I execute the last script. In the manual this script is named miRDeep.pl, but in the zipped file that you can download its name is miRDP.pl. Is this normal? Am I using an incorrect file?

    Anyway, if I use this miRDP.pl script it returns me multiple error “problem in read format". I will paste here a little part of my files and my command line in case of someone can help me.

    Thank you in advance!

    Command line: perl miRDP.pl LC30_miRDeep_signatures LC30_miRDeep_structures > LC30_miRDeep_prediction

    LC30_miRDeep_signatures:
    ILLUMINA-8C6145:810:MP-SR4:1:2:3109:6128 23 1..23 chr01_0 250 23..45 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:92:7614:17418 25 1..25 chr01_1000 250 204..228 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:64:10868:11129 18 1..18 chr01_1001 250 23..40 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:64:10868:11129 18 1..18 chr01_1002 250 211..228 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:70:10235:17534 22 1..22 chr01_100 250 207..228 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:32:8332:13923 24 1..24 chr01_1003 250 23..46 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:64:13668:14678 24 1..24 chr01_1003 250 23..46 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:2:74:14818:9808 24 1..24 chr01_1003 250 23..46 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:32:8332:13923 24 1..24 chr01_1004 250 205..228 1e-04 1.00 42.1 Plus / Plus
    ILLUMINA-8C6145:810:MP-SR4:1:64:13668:14678 24 1..24 chr01_1004 250 205..228 1e-04 1.00 42.1 Plus / Plus

    LC30_miRDeep_structures:
    >chr01_0 strand:+ excise_beg:22126 excise_end:22375
    CAAACGACGACGAGGGAGGUGGCAGGACGCGUCCCACGAGGUGGCUUGUCCAUAGAAGGUGGCAGUUGGCAAUGAAAAAACAAAAAACAGUGGAAACGCAGUCAGCAAUGACAUGGUCCCGAUGGAGAUAGAAACAACAACAAUUAGCUCUGGUGGUGAACACGACCAGGUGAGUGUGUCAAAAUGCGUUUCCGGACAAGGGGUUAUGGUUUCCUUAAACGCGCUGGAGAAACGAAAGACGGAAAAAAGA
    ....(.((..((.((((.(((......))).)))).))..)).)(((((((........((.(....).))....................(((((((((((((....))))....(((....)))..........(((.((....((.(((((.((....)).)))))))...))))).....))))))))))))))))..(((.(.(((((((..........)).))))).)..))).......... (-64.70)
    >chr01_1 strand:+ excise_beg:21943 excise_end:22192
    UCUGUUGGUGAACACGAUCGGAUGAGUGCAUGAAAAUGUGUUCCUGGAUAAAAGGGUUUCAGUUUCUUGAACGCGUAGGAGGAAUGAAAGACGGAGAAAAAAUGACUAACACUGUUCAUCGUCUUCGCUAGCCGAAACGAGAAAUAUAAUUGGAGGAAAGAUCGGCGUCGGUGCUUCGGCGACCAAACGACGACGAGGGAGGUGGCAGGACGCGUCCCACGAGGUGGCUUGUCCAUAGAAGGUGGCAGUU
    .((((.......(((..(((((((((.((((....))))..((((.......))))(((((((((((((..((..((((((((.(((..(((((.................)))))..)))))))).)))..))...)))))))).....)))))........((((((((....)))))).))...(.((..((.((((.(((......))).)))).))..)).))))))))...))..))))))).. (-66.40)
    >chr01_2 strand:+ excise_beg:56028 excise_end:56277
    GAGCUUAAGAUUCUGAGAAGCAGUUGAUAGGUAGCCAACUUCUAAAAAUCUGAAAAAGCUGGGUUUCUCAGCUUCUGACUUCUAGUUCAUUUUCUGGACUCUAUAACUACAGCUUCUCAGAAUCUGGACCAAAAGCUGGAUUGUUUAGAUGAGCUUCUGAUUCUAGAAAAAACUGCAGCAGCAAGCUCCCCAAACAGACCCUUAAGAGUCUCGUAGGAAAAAAAAUAAUAUUGGUUGGAUACAUUUGAUU
    .......(((((((((((((((((((.((((........(((.........))).((((((((...))))))))......(((((........))))).)))))))))...)))))))))))))).((((((((((......))))....(((((((((.((.(((......))).))))).)))))).((..((((((........)))).)).)).............)))))).............. (-59.10)
    Patrícia Baldrich González
    Departament of Molecular Genetics
    Center for Research in Agricultural Genomics(CRAG) Parc de Recerca UAB
    Edifici CRAG, Campus UAB Bellaterra (Cerdanyola del Vallés)
    08193 BARCELONA SPAIN
    0034 93 563 6600 Ext. 3124
    Email: [email protected]
  • Latifa77
    Junior Member
    • Sep 2013
    • 6

    #2
    Hi, do you keep using mirDeep-P? Could you solve your problem and have good results?

    Comment

    • PatB
      Junior Member
      • Feb 2013
      • 3

      #3
      Hi!

      Yes finally I solve the problem and miRDEEP -p is working properly. It was a mistake in the ID name of the reads. Thanks!
      Patrícia Baldrich González
      Departament of Molecular Genetics
      Center for Research in Agricultural Genomics(CRAG) Parc de Recerca UAB
      Edifici CRAG, Campus UAB Bellaterra (Cerdanyola del Vallés)
      08193 BARCELONA SPAIN
      0034 93 563 6600 Ext. 3124
      Email: [email protected]

      Comment

      • Latifa77
        Junior Member
        • Sep 2013
        • 6

        #4
        I have a question, when you run the script rm_redundant_meet_plant.pl did you see lines with this comment in the terminal??:

        Use of uninitialized value in subtraction (-) at ./rm_redundant_meet_plant.pl line 147, <FILE> line 792223

        I am trying to uses mirdeep-p but I think my results are not good.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 08-06-2026, 07:41 AM
        0 responses
        14 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-03-2026, 10:13 AM
        0 responses
        31 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-31-2026, 02:55 AM
        0 responses
        40 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-24-2026, 12:17 PM
        0 responses
        26 views
        0 reactions
        Last Post SEQadmin2  
        Working...