Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Calculating consensus quality scores

    Hi All,
    I am new to this forum and looking for advice on what the proper way is to calculate a consensus quality scores for paired end reads. Here's a concrete example of a portion of 2 aligned reads and their scores:

    fragment1 - GGAGGATGCGAGCGTTATCCGG-ATTTATTGGGTTTAAA
    fragment2 - CGAGGGTGCAGGGGTTAACCGGAATTTA-TGGGTGTGAA
    contig - GGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAA

    base1 base2 score1 score2
    G C 33 12
    G G 32 26
    A A 32 12
    G G 31 12
    G G 33 14
    A G 17 24
    T T 34 12
    G G 37 12
    C C 37 12
    G A 17 26
    A G 36 24
    G G 37 12
    C G 38 14
    G G 38 14
    T T 38 24
    T T 38 26
    A A 38 12
    T A 38 12
    C C 38 12
    C C 39 14
    G G 38 14
    G G 38 26
    - A 33 14
    A A 38 14
    T T 38 24
    T T 38 14
    T T 38 14
    A A 39 14
    T - 39 12
    T T 38 26
    G G 39 12
    G G 37 26
    G G 39 26
    T T 36 14
    T G 36 26
    T T 36 26
    A G 37 12
    A A 39 37
    A A 39 31

    How would you calculate the contigs quality scores? Would you suggest different methods for bases that match? bases that don't? and gap to base situations? Thanks in advance for your help!

    Kindly,
    Sarah

  • #2
    Are "fragment 1" and "fragment 2" paired-end reads and "contig" an example alignment of them to the reference? From your phrasing, it's difficult to tell if you want a mapping score or a consensus Phred score for the base calls.

    Comment


    • #3
      Thanks for your response and question. Let me try to clarify a bit. Fragment 1 is a portion of the forward read and Fragment 2 a portion of the reverse read. They are aligned to each other and the posted section is part of where they overlap. The contig is an assembly of the 2 fragments. In this simple example, where the bases in the fragments are mismatched the base with the better quality score was selected to be part of the contig. For the line: "G C 33 12" 33 is the quality score for the base G taken directly from the fastq file and 12 is the quality score for the base C. G is selected as the base in the contig, but how would you suggest calculating the quality score for G in the contig?

      Comment


      • #4
        The quality scores you are looking at are for the individual bases and express reliability of the base call at that position (http://en.wikipedia.org/wiki/FASTQ_format#Quality). It is probably not appropriate to simply add/average them.

        If these reads are overlapping then you may want to use a program to collapse them into a single representation. http://thegenomefactory.blogspot.com...aired-end.html

        Your downstream application may also determine how you want to handle them.

        Comment


        • #5
          Thanks for the links. I work for the mothur project. We have a command, make.contigs http://www.mothur.org/wiki/Make.contigs that assembles overlapping paired end reads. The tool currently assembles the contigs taking into account inserts, mismatches and the difference in the quality scores. We have had some requests for assembled quality data and are interested the communities thoughts on the best way to do this. Your thoughts?

          Comment


          • #6
            Originally posted by mothurwestcott View Post
            Thanks for the links. I work for the mothur project. We have a command, make.contigs http://www.mothur.org/wiki/Make.contigs that assembles overlapping paired end reads. The tool currently assembles the contigs taking into account inserts, mismatches and the difference in the quality scores. We have had some requests for assembled quality data and are interested the communities thoughts on the best way to do this. Your thoughts?
            If the bases are matching then potentially you could keep the higher of the two quality values considering positional context of the base in the read.

            Comment


            • #7
              How you combine these scores depends on the platform you are using, as the Phred scores are calculated differently.

              If they are Illumina scores, I believe it is appropriate to add the scores together, as they are log transformed scores reflecting the likelihood of the base call being in error so adding them is equivalent to multiplying the likelihood of each call (i.e. the probability of base 1 AND base 2 being in error). This causes very high Phred-like scores in some instances, but from what I have read, this reflects the inaccuracy of Illumina's Phred scores rather than the methodology used to combine.

              I am very happy to be corrected on this!

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Investigating the Gut Microbiome Through Diet and Spatial Biology
                by seqadmin




                The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...
                02-24-2025, 06:31 AM
              • seqadmin
                Quality Control Essentials for Next-Generation Sequencing Workflows
                by seqadmin




                Like all molecular biology applications, next-generation sequencing (NGS) workflows require diligent quality control (QC) measures to ensure accurate and reproducible results. Proper QC begins at nucleic acid extraction and continues all the way through to data analysis. This article outlines the key QC steps in an NGS workflow, along with the commonly used tools and techniques.

                Nucleic Acid Quality Control
                Preparing for NGS starts with isolating the...
                02-10-2025, 01:58 PM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 03-03-2025, 01:15 PM
              0 responses
              28 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-28-2025, 12:58 PM
              0 responses
              124 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-24-2025, 02:48 PM
              0 responses
              485 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 02-21-2025, 02:46 PM
              0 responses
              241 views
              0 likes
              Last Post seqadmin  
              Working...
              X