Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • mothurwestcott
    Junior Member
    • Oct 2013
    • 3

    #1

    Calculating consensus quality scores

    Hi All,
    I am new to this forum and looking for advice on what the proper way is to calculate a consensus quality scores for paired end reads. Here's a concrete example of a portion of 2 aligned reads and their scores:

    fragment1 - GGAGGATGCGAGCGTTATCCGG-ATTTATTGGGTTTAAA
    fragment2 - CGAGGGTGCAGGGGTTAACCGGAATTTA-TGGGTGTGAA
    contig - GGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAA

    base1 base2 score1 score2
    G C 33 12
    G G 32 26
    A A 32 12
    G G 31 12
    G G 33 14
    A G 17 24
    T T 34 12
    G G 37 12
    C C 37 12
    G A 17 26
    A G 36 24
    G G 37 12
    C G 38 14
    G G 38 14
    T T 38 24
    T T 38 26
    A A 38 12
    T A 38 12
    C C 38 12
    C C 39 14
    G G 38 14
    G G 38 26
    - A 33 14
    A A 38 14
    T T 38 24
    T T 38 14
    T T 38 14
    A A 39 14
    T - 39 12
    T T 38 26
    G G 39 12
    G G 37 26
    G G 39 26
    T T 36 14
    T G 36 26
    T T 36 26
    A G 37 12
    A A 39 37
    A A 39 31

    How would you calculate the contigs quality scores? Would you suggest different methods for bases that match? bases that don't? and gap to base situations? Thanks in advance for your help!

    Kindly,
    Sarah
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    Are "fragment 1" and "fragment 2" paired-end reads and "contig" an example alignment of them to the reference? From your phrasing, it's difficult to tell if you want a mapping score or a consensus Phred score for the base calls.

    Comment

    • mothurwestcott
      Junior Member
      • Oct 2013
      • 3

      #3
      Thanks for your response and question. Let me try to clarify a bit. Fragment 1 is a portion of the forward read and Fragment 2 a portion of the reverse read. They are aligned to each other and the posted section is part of where they overlap. The contig is an assembly of the 2 fragments. In this simple example, where the bases in the fragments are mismatched the base with the better quality score was selected to be part of the contig. For the line: "G C 33 12" 33 is the quality score for the base G taken directly from the fastq file and 12 is the quality score for the base C. G is selected as the base in the contig, but how would you suggest calculating the quality score for G in the contig?

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        The quality scores you are looking at are for the individual bases and express reliability of the base call at that position (http://en.wikipedia.org/wiki/FASTQ_format#Quality). It is probably not appropriate to simply add/average them.

        If these reads are overlapping then you may want to use a program to collapse them into a single representation. http://thegenomefactory.blogspot.com...aired-end.html

        Your downstream application may also determine how you want to handle them.

        Comment

        • mothurwestcott
          Junior Member
          • Oct 2013
          • 3

          #5
          Thanks for the links. I work for the mothur project. We have a command, make.contigs http://www.mothur.org/wiki/Make.contigs that assembles overlapping paired end reads. The tool currently assembles the contigs taking into account inserts, mismatches and the difference in the quality scores. We have had some requests for assembled quality data and are interested the communities thoughts on the best way to do this. Your thoughts?

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #6
            Originally posted by mothurwestcott View Post
            Thanks for the links. I work for the mothur project. We have a command, make.contigs http://www.mothur.org/wiki/Make.contigs that assembles overlapping paired end reads. The tool currently assembles the contigs taking into account inserts, mismatches and the difference in the quality scores. We have had some requests for assembled quality data and are interested the communities thoughts on the best way to do this. Your thoughts?
            If the bases are matching then potentially you could keep the higher of the two quality values considering positional context of the base in the read.

            Comment

            • Jegar
              Junior Member
              • Aug 2014
              • 6

              #7
              How you combine these scores depends on the platform you are using, as the Phred scores are calculated differently.

              If they are Illumina scores, I believe it is appropriate to add the scores together, as they are log transformed scores reflecting the likelihood of the base call being in error so adding them is equivalent to multiplying the likelihood of each call (i.e. the probability of base 1 AND base 2 being in error). This causes very high Phred-like scores in some instances, but from what I have read, this reflects the inaccuracy of Illumina's Phred scores rather than the methodology used to combine.

              I am very happy to be corrected on this!

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, Today, 07:41 AM
              0 responses
              5 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              21 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              35 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              25 views
              0 reactions
              Last Post SEQadmin2  
              Working...