Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Help needed to prepare consensus including overhangs

    I am having trouble merging my pre-trimmed fastq files to merge with the inclusion of the overhangs/nonoverlapping reads at either end. have many files and here is an example.


    @S1_A01_015_F ATTTATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTACGATCCATCAGGCGGAGGAGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG

    + 9>%*ROOAB,78K[[[[W>W:0G6J@RP_J__Y_TPK_W_MRP\\\_W;W____\W_____W\W______WK__RW__RKWWW__RW__W_WRW________________WWWW\YW___WWWW______WW_WWW_____W________\S______LRRW_____Y_____________W__________________________________W________________________________WRRWWW___________________________________RRR_____________________O_________[[[[R[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[WW[[[[[[[[[[[[[[[[[[[[[R[[[[[[W[T[[[[[[[[[[[[R[[[[[[W[[R[[[MQ[[SO[W[LJB[[HMLWRT[[UPRSSSSJ=ISLM[ISIHKSS>@[IDD''&&&&<A5-((5


    @S1_A01_015_R CTCCTCGCCTGATGGATCGTAAAAGATGTATTTAAGTTTCTATCAGTTAATAACATAGTAATTGCACCAGCTAATACAGGTAAAGTTAATAATAATAAAAAAGCAGTAATAAATATAGCCCAAACAAATAAAGGTAATCTATGAAAACTTAAACCTGGAGCTCTCATATTATAAATAGTAGATAAAAAATTAATAGCACCTAATAAAGAAGAAATACCTGATAAATGTAAACTAAAAATAGCTAAATCTACTGAAGGACCTGAATGTGCTTGTACACTTGATAAAGGAGGATATACAGTCCAACCAGTACCTGCACCTGATTCAACAATAGCTGAAGAAACTAATAATAATAATGATGGTGGTAATAACCAAAAACTTATATTATTCATACGAGGAAAAGCCATATCTGGAGCACCAATCATTAAAGGTACAAACCAATTACCAAAACCACCTATTAAAACAGGCATAACCATAAAAAAAATCATAATAAATGCATGTGCTGTAACAACAACATTATATAAATGATGATTCCCAGCAAAAATTTGATTACCGGGTTGTGCTAATTCCATTCTAATTAAAACAGATAATGTAGTTCCTACTACACCAGAAAAAGCACCAAAAATTAAATATAAAGTACCTATGTCTTTATGATTTGTTGAAAA

    + B+'2+(0C2W:0[C4'L4(')/=1:?HJ[J<=7____HH_GJI_FS_Y__PP_R___TN_\T_\M__\\OY____RR__W\OSYYW_Y___\\YCLW_____W_\WW_\\Y_YWYWW___Y_W\SAG<KQY_WRW_____YWQWY_O\EYYQN_WC\Y\Y\_\___Y___YWW_Y__WQY_Y_Y__\_Y__KYYWLLW_SWWO_OY_\Y_________YYLLWQE\R\\YMYYOOY___________YYYYY\OOY\_N_SRFG__Y\YYY_YORR_Y__Y__YR___YYYOY__________Y____LYY_OO_Y_____L_Y___YY_________O______________YYLJOYH?=OL___________MU_U[NUNMOUURWOQUUUPIIW[OMWOU7?OUUUPWU[[[UUN[WNLW[[WWUWNMU[[U[U[UDLC[QSHRWRSPWQMPQS[VTS[JJPPS[TTTT[[[PQR[[[[[RRJHMRTQQRR[W[R[[LQQSW@MLA9J1QQKL

    now i need to merge such forward and reverse reads to get something like below as a merged consensus that includes not only the overlapped region but also the region that does not overlap to make a full consensus.
    Any leads or custom script using bbmerge? I am a beginner and could not figure out. Thanks for the help.
    Click image for larger version

Name:	dataurl463183.jpg
Views:	152
Size:	39.3 KB
ID:	325489

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
24 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
45 views
0 likes
Last Post seqadmin  
Working...
X