Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • wskwxf
    Junior Member
    • Oct 2012
    • 6

    BWA error

    I am trying to map a read to hg19 using BWA(0.7.4-r385).it's show "Segmentation fault",but I cut the read to two sequences,then it's normally.
    Read:
    @HWI-ST1066:139:H157AADXX:1:2111:13586:46539 2:N:0:GATAGACA
    CCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCATAGG
    +
    00<<BBBBBBBBBB<BBBBBBBBBBBBB<BBB7<07<<BBBBB<<<<<<<<<<<77<0<0<7<7<0<'''00
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Is this a real or a virtual server? What OS are you using? Did you compile the program (and build the indexes) yourself on this machine? Amount of memory?

    Comment

    • wskwxf
      Junior Member
      • Oct 2012
      • 6

      #3
      it's a real,use centos,and compile the program myself.Now,the problem is solved,but that use bwa v0.6.2, I thinks that problem is new version(bwa-0.7.5) bug.

      Comment

      • winsettz
        Member
        • Sep 2012
        • 91

        #4
        0.75 or 0.75a?

        Also, bwa sampe or bwa mem?

        Comment

        • wskwxf
          Junior Member
          • Oct 2012
          • 6

          #5
          Originally posted by winsettz View Post
          0.75 or 0.75a?

          Also, bwa sampe or bwa mem?
          I have tested the two versions,used bwa sampe

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Today, 11:41 AM
          0 responses
          9 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-20-2026, 11:10 AM
          0 responses
          21 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          34 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          44 views
          0 reactions
          Last Post SEQadmin2  
          Working...