Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • gsMapper: how to reduce number of gaps ?

    We would like to ask whether anyone else has seen the same problems when using 454's gsMapper with a set of reads and a reference sequence. How can one reduce the number of gaps that were introduced by the mapping alogrithm?

    Problem 1:
    In the ace file, one often sees gaps introduced by gsMapper at the begin of a read that could be perfectly aligend to the reference sequence. We think that this gap is a bug in the algorithm and should be avoided. Is there a gsMapper parameter that can be modified in order to prevent such gaps? Gaps are introduced only at the begin of a read, not at the end.

    HTML Code:
    read_1 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_2 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_3 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_4 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_5 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_6 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_7      TTGCTTTAAGTGCTTGTTTATTCAT
    read_8      TTGCTTTAAGTGCTTGTTTATTCAT
    read_9 GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    read_10  C.GTTGCTTTAAGTGCTTGTTTATTCAT
    read_11                     TT.ATTCAT
    read_12                         T.CAT
     
    contig GTCCGTTGCTTTAAGTGCTTGTTTATTCAT
    ref    GTCcGTTGCTTTAAGTGCTTGTTtATtCAT


    Problem 2:
    At another position in the ace file, gsMapper inserts gaps to avoid a mismatch. We want that the alignment has higher priority than inserting gaps. Is there a parameter in gsMapper that prevents such gaps? In the cases shown below, we prefer a mismatch than a gap.
    HTML Code:
    read_1  CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_2  CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_3  CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_4  CCN.GAAACGN.GGAGACTCTTGGGA.TAGCG 
    read_5  CC.AGAAACGN.GGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_6  CC.AGAA.CG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_7  CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_8  CC.AGAAACG.AGGAGA 
    read_9  CC.AGAAACG.AGGAGAC 
    read_10 CC.AGAAACG.AGGAGACTC 
    read_11 CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_12 CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_13 CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_14          G.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_15            AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    read_16             G.AGACTCTTGGGA.TAGCGCCAAGC.CA
    read_17                  CTCTTGG.AATAGCGCCAAG.TCA
    read_18                            TAGCGCCAAG.TCA
    read_19                                   A.G.TCA
     
    contig  CC.AGAAACG.AGGAGACTCTTGGGA.TAGCGCCAAG.TCA
    ref     CC-aGAAaCG-aGgAGACTCTTGGgA-TAGCGCCAaG-tCA
    Many thanks for help!

  • #2
    Problem 1 does look like a bug, probably related to how differences in homopolymer runs are normally handled in the middle of the alignment.

    I'm aware of other people grumbling about Problem 2, since this kind of output makes various downstream SNP finders unhappy. I'd have to ask around, but I suspect they took the practical way out and wrote a script to "fix" the alignment from Newbler.
    Last edited by maubp; 03-03-2010, 05:19 AM. Reason: typo

    Comment


    • #3
      What version of gsAssember are you using? Reportedly "Problem 2" was fixed in Newbler 2.3 (something neither I nor the colleague I just spoke to have verified personally).

      Comment


      • #4
        Thanks for your help.

        Yes, we are using the latest version 2.3

        Comment


        • #5
          Oh. I'm not in the office today, but I'll make a mental note to ask the other group more about this next time I see them.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Current Approaches to Protein Sequencing
            by seqadmin


            Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
            04-04-2024, 04:25 PM
          • seqadmin
            Strategies for Sequencing Challenging Samples
            by seqadmin


            Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
            03-22-2024, 06:39 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 04-11-2024, 12:08 PM
          0 responses
          18 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 10:19 PM
          0 responses
          22 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 09:21 AM
          0 responses
          17 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-04-2024, 09:00 AM
          0 responses
          49 views
          0 likes
          Last Post seqadmin  
          Working...
          X