Does anyone know if Bioscope sam output's mapping quality score follows sam specifications? I noticed I have a lot of 0's in the 4th mapping quality column in my Bioscope output alignments. I also see some 100's. I thought mapping quality is 0-99?
-
Last edited by damiankao; 03-22-2010, 07:17 AM. -
Mapping quality is between 0 and 255.Originally posted by damiankao View Post -
what version of BS are you using? Those that version dumps BAMs directly or you have to postprocess to convert to BAM/SAM?Originally posted by damiankao View Post
Can you dump some entries from your BAM?-drdComment
-
I am using the version that dumps .bam. Then I post-process to .sam and cleaned it up for cufflinks.
Here's a few entries with really low scores.
Code:1847_606_2027 256 Contig78899 2917 0 31M19H * 0 0 TGAATGACCTTGACCTACTTTTCAATGACCT DIFE>DIII'&->E4AIHFH;.:IIFAFID2 XS:A:+ 763_1093_180 256 Contig78899 2917 1 34M16H * 0 0 TGAATGACCTTGACCTACTTTTCAATGACCTTGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII:H XS:A:+ 955_1354_927 256 Contig78899 2917 1 27M23H * 0 0 TGAATGACCTTGACCTACTTTTCAATG 77CIEEIIIIHFDIIIHGIIIDIIIA1 XS:A:+ 1347_1328_414 256 Contig78899 2919 0 15H31M4H * 0 0 AATGACCTTGACCTACTTTTCAATGACCTTG EAIIIIE<0:%%II>FIIIIIIIIIIIIDII XS:A:+ 1062_1345_1564 272 Contig78899 2919 0 21H29M * 0 0 AATGACCTTGACCTACTTTTCAATGACCT I6EIII&&IIIGIIIII=>I>%%:IIICI XS:A:- 1648_875_1465 272 Contig78899 2921 0 22H28M * 0 0 TGACCTTGACCTACTTTTCAATGACCTT "7G7*-;FE<1AI=4##IIIIIIIIIII XS:A:- 1314_701_16 272 Contig78899 2922 0 23H27M * 0 0 GACCTTGACCTACTTTTCAATGACCTT %+1,-6C%%.*5##7:IIIIIIIIIII XS:A:- 1551_763_1651 272 Contig78899 2922 0 23H27M * 0 0 GACCTTGACCTACTTTTCAATGACCTT "I=,2CIF>$$;>70DIIIIIIIIIII XS:A:- 1238_1512_669 272 Contig78899 2940 0 24H26M * 0 0 AATGACCTTGAAAAATTATGATGAGT IGIIIIIIIIIII==I><IIIIIIII XS:A:-
Comment
-
Any chance you can tell us the version you are using?
Also, is there any parameter to make the bam store the original CS calls?-drdComment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM
Comment