Then you should consider that overlap is something like:
R1-ATTGCTGTG
-----------ACACTGAAAAGT-R2
R1-ATTGCTGTG
-----------ACACTGAAAAGT-R2
-
-
how you got these reads !! ??Comment
-
Oh, that's just an example of what paired-end pairing looks like.Comment
-
for example:
we have a fragment of DNA: ATCGTTGAGCAGACT
we will sequence this fragment and for example after the paired end sequencing reads we have R1 and R2 with a length 6. Thus:
R1 = ATCGTT
R2 = AGTCTG (reverse complement)
so after sequencing wa have R1..... R2 (the middle part is unknown).
that's the paired end reads.
or not?Comment
-
No. If you have a fragment of DNA: ATCGTTGAGCAGACT,
your R1: TAGCAA
and R2: GTCTGAComment
-
how make an assembly with reads (paired end: two files) .
Is it that you can make an example please?
thanksComment
-
Assembly algorithm will depend whether you have a reference genome or not. Is it a metagenome sequencing?Comment
-
no. i have illumina paired end reads. and I want to denovo assembly without a reference genome.
how the right portion of a reads overlaps with the left portion of another reads? (it was not the same sense od read)
And have you an exampleComment
-
Left and right are not complements of each other. They match. That's how they overlap. For denovo assembly try using programs like SOAP denovo
http://soap.genomics.org.cn/soapdenovo.html, or SPADES de novo http://bioinf.spbau.ru/en/. Are your sequences from single cell? Or a metagenome?Comment
-
I know the operation of assembly programs.
but I basically want to understand the overlap between the paired end reads (the two files).
i have single cell not meta genome.
have you an example?Comment
-
what example are you looking for?Comment
-
for example we have two fragments.
S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT
we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
S1:R1: ATCGTTGAGCA
S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
S2:R1:TGAGCAGACTT
S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.
how to make assembly in this case?Comment
-
R2 reads are not in a form of reverse complement.Comment
-
illumina read the fragment from the right.Originally posted by OTU View Post
so if S1 is read from right, is that we take the reverse complement fragment or fragment from the right?
In this case R2 is what?Comment
-
Sorry, you are right. I meant something different.
Your previous post depicts the assembly process correctly.
What I don't understand is what exactly is your question then?Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...Today, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment