Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • OTU
    Member
    • May 2013
    • 44

    #61
    Then you should consider that overlap is something like:
    R1-ATTGCTGTG
    -----------ACACTGAAAAGT-R2

    Comment

    • mido1951
      Senior Member
      • May 2014
      • 123

      #62
      how you got these reads !! ??

      Comment

      • OTU
        Member
        • May 2013
        • 44

        #63
        Oh, that's just an example of what paired-end pairing looks like.

        Comment

        • mido1951
          Senior Member
          • May 2014
          • 123

          #64
          for example:
          we have a fragment of DNA: ATCGTTGAGCAGACT
          we will sequence this fragment and for example after the paired end sequencing reads we have R1 and R2 with a length 6. Thus:
          R1 = ATCGTT
          R2 = AGTCTG (reverse complement)
          so after sequencing wa have R1..... R2 (the middle part is unknown).
          that's the paired end reads.
          or not?

          Comment

          • OTU
            Member
            • May 2013
            • 44

            #65
            No. If you have a fragment of DNA: ATCGTTGAGCAGACT,
            your R1: TAGCAA
            and R2: GTCTGA

            Comment

            • mido1951
              Senior Member
              • May 2014
              • 123

              #66
              how make an assembly with reads (paired end: two files) .
              Is it that you can make an example please?
              thanks

              Comment

              • OTU
                Member
                • May 2013
                • 44

                #67
                Assembly algorithm will depend whether you have a reference genome or not. Is it a metagenome sequencing?

                Comment

                • mido1951
                  Senior Member
                  • May 2014
                  • 123

                  #68
                  no. i have illumina paired end reads. and I want to denovo assembly without a reference genome.
                  how the right portion of a reads overlaps with the left portion of another reads? (it was not the same sense od read)
                  And have you an example

                  Comment

                  • OTU
                    Member
                    • May 2013
                    • 44

                    #69
                    Left and right are not complements of each other. They match. That's how they overlap. For denovo assembly try using programs like SOAP denovo
                    http://soap.genomics.org.cn/soapdenovo.html, or SPADES de novo http://bioinf.spbau.ru/en/. Are your sequences from single cell? Or a metagenome?

                    Comment

                    • mido1951
                      Senior Member
                      • May 2014
                      • 123

                      #70
                      I know the operation of assembly programs.
                      but I basically want to understand the overlap between the paired end reads (the two files).
                      i have single cell not meta genome.
                      have you an example?

                      Comment

                      • OTU
                        Member
                        • May 2013
                        • 44

                        #71
                        what example are you looking for?

                        Comment

                        • mido1951
                          Senior Member
                          • May 2014
                          • 123

                          #72
                          for example we have two fragments.
                          S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT

                          we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
                          S1:R1: ATCGTTGAGCA
                          S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
                          S2:R1:TGAGCAGACTT
                          S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.

                          how to make assembly in this case?

                          Comment

                          • OTU
                            Member
                            • May 2013
                            • 44

                            #73
                            R2 reads are not in a form of reverse complement.

                            Comment

                            • mido1951
                              Senior Member
                              • May 2014
                              • 123

                              #74
                              Originally posted by OTU View Post
                              R2 reads are not in a form of reverse complement.
                              illumina read the fragment from the right.
                              so if S1 is read from right, is that we take the reverse complement fragment or fragment from the right?
                              In this case R2 is what?

                              Comment

                              • OTU
                                Member
                                • May 2013
                                • 44

                                #75
                                Sorry, you are right. I meant something different.
                                Your previous post depicts the assembly process correctly.
                                What I don't understand is what exactly is your question then?

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                17 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                15 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                13 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...