bases after adapter contamination

[canerb]

Hi everyone,

I was recently experimenting with simNGS, the NGS simulation tool of EBI (https://www.ebi.ac.uk/goldman-srv/simNGS/), to create a test dataset for myself. I added a custom adapter sequence to the sequencing setup and ran the simulation. Then when I grepped for the adapter in the produced reads, I see some random nucleotides after the complete adapter sequence at 3' end. I'm wondering how this is possible?

To my knowledge, adapter contamination occurs when the fragment length is shorter than the read length (which I allowed in my simulation), but shouldn't the reaction terminate after going through the complete adapter sequence? Where are those further nucleotides can be possibly coming from? (They are not multiplexed adapters, they are just random as far as I can tell)

Thanks for your replies.

[Brian Bushnell]

After the adapter sequence finishes at, say, cycle 80 of a 100 bp read, the sequencing machine is still going to run 20 more cycles, and put *something* in the output file. Since there is nothing more to sequence, it will probably just be highly-amplified random ambient light, giving random bases. Hopefully they will have very low quality scores.

[nucacidhunter]

Oligos complementary to 5’ motif of P5 and P7 adapters immobilised on flow cell has a stretch of 10 poly T on their 5’. So, in real data when the sequencing reaction reads through adapters it hits the poly T and results in calling A bases. After calling 10 A, it somehow calls mix of predominantly A and some C probably picking up signals from nearby clusters.

[nucacidhunter]

Here is a screen shot from read2 of sequencing runs longer than insert size. PolyA is evident after adpter sequences.

[Brian Bushnell]

Here is a screen shot from read2 of sequencing runs longer than insert size. PolyA is evident after adpter sequences.

Nice picture; thanks! Seems like the poly-A can be as short as 2 in that data. Do you know how universal the presence of post-adapter poly-A is through various library protocols?

[GenoMax]

This observation is real but it is curious that simNGS has that implemented in a simulator. Kudos to the developer(s).

[nucacidhunter]

Any library that can be sequenced on Illumina systems would have poly A tract after running through adpters. Poly T is used as spacer between flow cell surface and oligos complementary to adapters P7 and P5 flow cell binding motif. In this case sequences following "CTCTGTGTAGATCTCGGTGGTCGCCGTATCATT" (P5 partial complement) are non-template sequences.

[canerb]

Thank you, I appreciate all the answers.

GenoMax, yeah I am surprised with that as well. They seem to have missed poly-A's though.