Dear all,
I am trying to de-multiplex a 454 fasta file.
It is a public data file. In the paper (PMID:21731642) the authors say that:
"The HB4a and C5.2 Y-shaped adapters were formed by primers A and B and primers C and D, respectively (Primer A: 5′-GATCTCCCGAGTGGTCACCTGCTC-3′; Primer B: 5′-CTAGCAGCTACCACTCGGGA-3′; Primer C: 5′-GATCCCCTGAGTGGTCACCTGCTC-3′, and Primer D: 5′-CTAGCAGCTACCACTCAGGG-3′)"
So I did two runs of demultiplexing:
Run1:
Run2:
On the first run there are no reads that map those 2 sequences.
On the second run there are many unmatched reads (>50% of reads do no match any barcode)
Am I doing something wrong?
Does anyone have experience with this type of problem?
Thanks!
I am trying to de-multiplex a 454 fasta file.
It is a public data file. In the paper (PMID:21731642) the authors say that:
"The HB4a and C5.2 Y-shaped adapters were formed by primers A and B and primers C and D, respectively (Primer A: 5′-GATCTCCCGAGTGGTCACCTGCTC-3′; Primer B: 5′-CTAGCAGCTACCACTCGGGA-3′; Primer C: 5′-GATCCCCTGAGTGGTCACCTGCTC-3′, and Primer D: 5′-CTAGCAGCTACCACTCAGGG-3′)"
So I did two runs of demultiplexing:
Run1:
Code:
$ cat barcode1.txt HB4a_1 GATCTCCCGAGTGGTCACCTGCTC C52_1 GATCCCCTGAGTGGTCACCTGCTC $ cat ../HER2_Dataset_Download/SRR342054_1.fastq | fastx_barcode_splitter.pl --bcfile barcode1.txt --bol --mismatches 2 --prefix SRR342054_1_ --suffix ".fastq" Barcode Count Location C52_1 0 SRR342054_1_C52_1.fastq HB4a_1 0 SRR342054_1_HB4a_1.fastq unmatched 802214 SRR342054_1_unmatched.fastq
Code:
$ cat barcode2.txt HB4a_2 CTAGCAGCTACCACTCGGGA C52 _2 CTAGCAGCTACCACTCAGGG cat SRR342054_1_unmatched.fastq | fastx_barcode_splitter.pl --bcfile barcode2.txt --bol --mismatches 2 --prefix SRR342054_2_ --suffix ".fastq" Barcode Count Location C52_2 214558 SRR342054_2_C52_2.fastq HB4a_2 165481 SRR342054_2_HB4a_2.fastq unmatched 422175 SRR342054_2_unmatched.fastq total 802214
On the second run there are many unmatched reads (>50% of reads do no match any barcode)
Am I doing something wrong?
Does anyone have experience with this type of problem?
Thanks!
Comment