Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • JenBarb
    Member
    • Oct 2010
    • 47

    Pull out unknown primers from fastq file?

    Hello,
    I have fastq files from 16S sequencing data. The reads in these files have 6 different primers in them and I am wondering if anyone knows of a method where I can pull out the beginning of the reads, maybe 20-30 bps and then look for consensus sequences within these? This will then give me the primer sequence information for the 6 primers which is proprietary information from the company where the kits are made.

    Can anyone think of a way to do this?
    Thanks!
  • cmbetts
    Senior Member
    • Jun 2012
    • 120

    #2
    Something like that should be pretty easy to do with any scripting language with fastq parsing libraries (or heck maybe manually inspecting the fastq since there's only 6 primers if you're not keen on programming).

    Example R psuedocode (only because that's what I'm comfortable with)
    library("ShortRead"); #load the library for fastq manipulation
    fq_data <- readFastq("reads.fastq.gz"); #read in fastq data
    base_info <- sread(fq_data); #get just the base calls
    first20 <- substring(base_info, 1, 20); #get the first 20bp of each read

    then you could do something like
    table(first20) to see the frequency of different 20bp sequences
    alphabetFrequency(first20) to get consensus sequences

    Comment

    • maubp
      Peter (Biopython etc)
      • Jul 2009
      • 1544

      #3
      IIRC, some FASTQ quality control pipelines will spot and report possible primer sequences.

      Comment

      • JenBarb
        Member
        • Oct 2010
        • 47

        #4
        maubp,
        I would love to find a tool that will spot and report possible primers. Can you be more specific?

        I tried to sort and tally up the sequences and i am not finding them this way. Which tool are you referring to?

        Thanks a bunch.
        Jen

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          e.g. FASTQC reports overrepresented sequences which ought to spot your primers:

          Comment

          • Brian Bushnell
            Super Moderator
            • Jan 2014
            • 2709

            #6
            If you have not solved this problem yet, there's another option, using BBTools:

            reformat.sh in=reads.fq out=trimmed.fq ftr=19

            This will trim all but the first 20 bases (all bases after position 19, zero-based).

            kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f
            This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel. For example:

            Code:
            ACCGTTACCGTTACCGTTAC	100
            AAATTTTTTTCCCCCCCCCC	85
            ...etc. If the primers are 20bp long, they should be pretty obvious.

            Comment

            • JenBarb
              Member
              • Oct 2010
              • 47

              #7
              Hi Brian,
              How should I cite your tool in a manuscript in prep that I am doing? Do you have a reference or should I use your website?
              Thanks,
              Jen

              Comment

              • Brian Bushnell
                Super Moderator
                • Jan 2014
                • 2709

                #8
                Hi Jen,

                My tools are all still unpublished, so please just cite my name and website. Thanks!

                -Brian

                Comment

                Latest Articles

                Collapse

                • mylaser
                  Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                  by mylaser
                  Kheloyaar: The Complete Guide to Kheloyaar Loginand Kheloyaar ID
                  The online gaming industry has transformed the way people enjoy digital entertainment. As technology continues to improve, players are looking for platforms that offer convenience, security, and a seamless user experience. Kheloyaarhas gained attention among users who value an easy-to-use platform, quick account access, and a simple registration process.
                  Whether you're exploring Kheloyaar for the first time or want to understand...
                  Today, 09:27 PM
                • SEQadmin2
                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                  by SEQadmin2



                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                  ...
                  Today, 11:10 AM
                • SEQadmin2
                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                  by SEQadmin2



                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                  Yesterday, 05:17 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, Today, 10:04 AM
                0 responses
                8 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, Yesterday, 10:08 AM
                0 responses
                7 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-07-2026, 11:05 AM
                0 responses
                10 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-02-2026, 11:08 AM
                0 responses
                31 views
                0 reactions
                Last Post SEQadmin2  
                Working...