Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • RNA-seq alignment for fly with bowtie

    HI Everyone,

    When I did alignment for my cDNA sample to fly genome with bowtie, the id for each read was set to FBgn#. But if I want to view the result with UCSC genome browser, I think the ID need to be chromosome location. Is there options in bowtie that when we do the alignment, we can set the ID to chromosome location?

    Thanks a lot in advance for help.

  • #2
    Is there a specific reason you want to visualize the data at UCSC? You could also use a local genome viewer like IGV from Broad.

    Did you create the transcriptome indexes yourself or did you download them from somewhere? Can you post a few lines from your SAM file (the chromosome locations may already be there, skip reference sequence headers if they are included)?

    Comment


    • #3
      Right now I already have the mapped data. But if there is an option to use chromosome localization, I can do it again by myself.
      Here is an example:
      HWI-ST484:183:C167BACXX:7:1103:13372:100580 0 FBgn0035951 49 255 49M * 0 0 GTTGAATTGGAACTATTTTTTTGTTTTCGAAAACGGATAATTGCGAGCA aabeeeeeggfggiiiiiiiiiihiiiihihhiiiiiiiihiihiiiig XA:i:0 MD:Z:49 NM:i:0
      Thanks~

      Comment


      • #4
        I am afraid you are going to have to re-do the alignments if you want to visualize the data for chromosomal locations. I would suggest that you download the indexes/annotations from iGenomes site: http://support.illumina.com/sequenci...e/igenome.html for UCSC build.

        Comment


        • #5
          Thanks, I will look there to find proper index. This is the example for the current index from flybase, I guess with this, I cannot get what I want no matter what...
          but if I don't need the transcript data, I can convert the gene information with a map table to chromosome localization.

          >FBtr0071764 type=mRNA; loc=2R:join(22137433..22138251,22151654..22151695,22162905..22163694,22164777..22164989,22169244..22170717,22170778..22171985,22172082..22172252,22172316..22172433,22172497..22172834); ID=FBtr0071764; name=a-RB; dbxref=FlyBase_Annotation_IDs:CG6741-RB,FlyBase:FBtr0071764,REFSEQ:NM_079902,REFSEQ:NM_079902; score=7; score_text=Moderately Supported; MD5=b3804d1c3dd8c6afd72ec955dc6c8c3b; length=5173; parent=FBgn0000008; release=r6.03; species=Dmel;
          CGAATACACAAATCAAAGCAAGTGTCTGTGTGATTGTAAAGAAGAATGTGCTAAGCAAATAAGGCAAATAACAACCATA
          TAACTGTAACTGAAATCCCACACTGAGAAAATAATCAGCGAAGAATAATATTTTGACATCCGTCTCTTGAAATATAAGA
          TCAAACTTTAGGTTAATACTCATTAGAAATATATCAATAAGCTATGAAATATCATTTAAATAAAAATGTAGTGATCTTA
          TTTTCATTTTTCTTCGTGCTCTCATAAGACAAGTTGATTGATTTGCGCAAAGGGAATTCGAGACACTTAAGATATTACC

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Exploring the Dynamics of the Tumor Microenvironment
            by seqadmin




            The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
            07-08-2024, 03:19 PM
          • seqadmin
            Exploring Human Diversity Through Large-Scale Omics
            by seqadmin


            In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
            06-25-2024, 06:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Yesterday, 06:53 AM
          0 responses
          12 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-10-2024, 07:30 AM
          0 responses
          34 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-03-2024, 09:45 AM
          0 responses
          204 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-03-2024, 08:54 AM
          0 responses
          213 views
          0 likes
          Last Post seqadmin  
          Working...
          X