bam-readcount warning

[balthasar]

hi everybody,

i am using bam-readcount to filter out false positives from snp calling.

i am getting (sometimes almost 5million) warnings like:
WARNING: In read XXX_XXX_XXX: Couldn't find single-end mapping quality. Check to see if the SM tag is in BAM.

what does it exactly mean?
(please find an example read pair below)

as you can see from the example, both reads have a proper mapq field, so,
1.) where is the problem?
2.) why does it need the sm tag?
3.) why is there no problem with most of the other reads?

thanks so much for any advice! chris

here is one of the read pairs,
XXX_XXX_XXX 99 1 565899 21 50M = 565967 68 CTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAA `````````````````````````````````````````````````A XA:i:3 MD:Z:2G35T11 XE:Z:-------------------------------------------------- PG:Z:bfast IH:i:1 NH:i:2 HI:i:1 CM:i:0 NM:i:2 CQ:Z:A<A=;>BBB<@>BB@ABBABAAAB?BBABB@BBB?BBA<BBBB@ABBBBA MQ:i:28 AS:i:2100 CS:Z:T22313302303223122011022103211112312200013332230110 RG:Z:4

XXX_XXX_XXX 147 1 565967 28 35M = 565899 -68 GTTTGAACACACAACACCCACCCCATTCCTCCCCA 2HNN""1`\SUX^`M9O````````````\````` XA:i:3 MD:Z:14A20 XE:Z:----11----------------------------- PG:Z:bfast IH:i:1 NH:i:2 HI:i:1 CM:i:2 NM:i:1 CQ:Z:@ABBB<7B?;@=BB=:BBA%+9@5:28;B21-8-2 MQ:i:21 AS:i:1300 CS:Z:T01000220203100011001110111111111001 RG:Z:4

[balthasar]

just in case anyone is interested:

https://github.com/genome/bam-readcount/issues/2