Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • cefanter
    Junior Member
    • Mar 2015
    • 2

    Appropriate Adapter Sequence fora trimming? RNAseq Transcriptome

    For previous studies I have contracted out both Illumina sequencing and RNAseq analysis of transcriptomes. An updated reference genome was added to NCBI this past year, and I want to take previously sequenced fastq files and realign them to the new reference genome in galaxy using Tophat and Cufflinks. I contacted the sequencing facilities to understand their protocol to determine if adapter sequences had been removed. They were unclear whether or not the trimming had already been executed, and their response time to my questions is lagging. They have however sent me this email.

    "We performed a polyA selection with a kit from Ambion: MicroPoly(A) Purist Kit; required 1000ng as starting material

    We used a cDNA kit from NuGEN: Ovation RNA-Seq System V2; we added 1ng of mRNA into the reaction. There is a SPIA adaptor sequence you will most likely want to trim off the 5' ends.
    We used an in house cocktail for the Illumina libraries (combination of kits from Lucigen and NEB); we initiated the Illumina libraries with 500ng of cDNA. We used the indexed Illumina adaptors:

    Multiplexing Adapters
    5' P-GATCGGAAGAGCACACGTCT
    5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

    Multiplexing PCR Primer 1.0
    5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

    Multiplexing PCR Primer 2.0
    5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

    PCR Primer, Index 1
    5’ CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC

    Let me know if you have more questions.

    Thanks!
    Catrina


    Index Sequence - XXXXXX
    Sample Library
    GCCGCG CPAM-RS15-RS15-V1 CPAM-RS15-RS15-V1-cDNA-1-lib1a
    GCTCCA CPAM-RS14-RS14-CS1 CPAM-RS14-RS14-CS1-cDNA-1-lib1a
    GGCACA CPAM-RS9-RS9-CS1 CPAM-RS9-RS9-CS1-cDNA-1-lib1a
    GGCCTG CPAM-RS12-RS12-V1 CPAM-RS12-RS12-V1-cDNA-1-lib1a
    GTCCGC CPAM-RS11-RS11-CS1 CPAM-RS11-RS11-CS1-cDNA-1-lib1a
    TAATCG CPAM-RS11-RS11-V1 CPAM-RS11-RS11-V1-cDNA-1-lib1a
    TACAGC CPAM-RS16-RS16-V1 CPAM-RS16-RS16-V1-cDNA-1-lib1a
    TATAAT CPAM-RS13-RS13-CS1 CPAM-RS13-RS13-CS1-cDNA-1-lib1a
    Index Sequence - XXXXXX Sample Library
    CACCGG CPAM-RS12-RS12-CS1 CPAM-RS12-RS12-CS1-cDNA-2-lib2a
    CCTTAG CPAM-RS9-RS9-V1 CPAM-RS9-RS9-V1-cDNA-2-lib2a
    CTCAGA CPAM-RS8-RS8-CS1 CPAM-RS8-RS8-CS1-cDNA-2-lib2a
    CTGCTG CPAM-RS8-RS8-V1 CPAM-RS8-RS8-V1-cDNA-2-lib2a
    GACGGA CPAM-RS13-RS13-V1 CPAM-RS13-RS13-V1-cDNA-2-lib1a
    GATATA CPAM-RS14-RS14-V1 CPAM-RS14-RS14-V1-cDNA-2-lib1a
    GATGCT CPAM-RS15-RS15-CS1 CPAM-RS15-RS15-CS1-cDNA-2-lib1a
    GTAGAG CPAM-RS16-RS16-CS1 CPAM-RS16-RS16-CS1-cDNA-2-lib1a "

    I want to make sure that there is no contamination of adapter sequences, even though the quality of my reads is high. I have tried creating a fasta file using the Multiplexing Adapters sequences listed above, and attempting trimming using Scythe, however the output file always is empty. Am I using the correct sequences? Do I need to trim individual fastq files using their appropriate indexes? I am still new to the process, so any advice would be appreciated.
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    I recommend creating a fasta file with all the sequences, except for the one with XXXXXX, make a copy of that with each index - GCCGCG, GCTCCA, etc. Then trim all of your reads with the same fasta file. Sometimes there is confusion about which orientation the adapters will be read in, so it may also be useful to try the reverse-complements as well if scythe doesn't do that automatically.

    If the reads have never been trimmed in any way, they will all be the same length.

    Comment

    • cefanter
      Junior Member
      • Mar 2015
      • 2

      #3
      Brian,

      Thanks for the advice.

      I am still having problems with trimming using the tool scythe in a local host galaxy. I went ahead and created a fasta file containing all of the adapters and their reverse sequences. The resulting output has a description of "no peek" and is empty. The fasta file is in the proper format with each adapter identification line starting with a ">" and a following line of sequence containing only basepair letters (see attached).

      Is this an internal problem with scythe downloaded to galaxy? would another tool be more appropriate for my need of trimming out adapters? What causes this no peek result?
      Attached Files

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Your adapter file appears to be valid. Unfortunately, I don't use Galaxy or Scythe, so I'm not sure what the problem might be, or what "no peek" is supposed to mean. If you are able to process your data on the command line, I suggest you try running BBDuk, like this:

        bbduk.sh in=reads.fastq out=trimmed.fastq ref=adapters.txt ktrim=r k=23 mink=11 hdist=1

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          I don't have access to a galaxy with scythe installed but I think this may be a problem with your local galaxy. Have you asked your local galaxy admins/support for help?

          There are many tools that can trim but you will need to work outside galaxy.

          Comment

          Latest Articles

          Collapse

          • mylaser
            Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by mylaser
            Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
            If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
            This guide explains everything you need to know about...
            Yesterday, 01:13 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          21 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          13 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Working...