Header Leaderboard Ad

Collapse

About Mosaik Assembler Consensus String

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • About Mosaik Assembler Consensus String

    Hello everybody,

    I just want to know how I can get a consensus string from the output of mosaik .ace file.

    If that's impossible, is there any other way to get the consensus string?

    Thanks

  • #2
    Unless I am mistaken or misunderstand your question, the ace file begins with the consensus, or rather, each contig entry in the ace file begins with the consensus, for example:

    Code:
    AS    8364 763600  
    
    CO contig00001 152567 9338 3216 U
    AgTTTTTg*TCAa*gCCGAAACCCGTAA*TCACAAAGGCTTTTTtGTGAA
    ACAAGgAGCCTATAaGTTAAAAAaTA*TTGATGAATCGGGTTGGGCTTTA
    ATCTGTG*TTGATG*A*CACCGTTTGTTATTACGTTGATCCCGATAATTT
    .... etc
    Just remove the '*' symbols (gaps introduced for optimizing alignemtn) and you're there.

    Comment


    • #3
      Thanks, maybe I have interpreted consensus wrong, but what I want is, if at certain bp the reads are different from the reference, I want the reads bp, instead of the reference.

      I ran a simple test assembly using Mosaik 1.0.1388, and the ace file looks like:

      Code:
      AS 1 3
      
      CO test 50 3 1 U
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      
      BQ ......
      
      AF .MosaikReference U 1
      AF read2 U 1
      AF read1 U 2
      BS 1 50 .MosaikReference
      
      RD .MosaikReference 50 0 0
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      
      RD read2 49 0 0
      AATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTT
      
      RD read1 49 0 0
      ATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG
      In this run, the consensus is identical to the reference at the red bp, i.e. T, but I wanted it to be G, like in the reads.
      Last edited by Iris Cristata; 07-04-2010, 07:00 PM.

      Comment


      • #4
        There is no simple way to get the consensus from an ACE file, simply because it's not in there.
        The CO tags represent the COntig sequences, what is usually the reference sequence in
        mapping approaches.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
          by seqadmin


          ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

          01-24-2023, 01:19 PM
        • seqadmin
          Introduction to Single-Cell Sequencing
          by seqadmin
          Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

          The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
          ...
          01-09-2023, 03:10 PM

        ad_right_rmr

        Collapse
        Working...
        X