About Mosaik Assembler Consensus String

[Iris Cristata]

Hello everybody,

I just want to know how I can get a consensus string from the output of mosaik .ace file.

If that's impossible, is there any other way to get the consensus string?

Thanks

[flxlex]

Unless I am mistaken or misunderstand your question, the ace file begins with the consensus, or rather, each contig entry in the ace file begins with the consensus, for example:

AS    8364 763600  

CO contig00001 152567 9338 3216 U
AgTTTTTg*TCAa*gCCGAAACCCGTAA*TCACAAAGGCTTTTTtGTGAA
ACAAGgAGCCTATAaGTTAAAAAaTA*TTGATGAATCGGGTTGGGCTTTA
ATCTGTG*TTGATG*A*CACCGTTTGTTATTACGTTGATCCCGATAATTT
.... etc

Just remove the '*' symbols (gaps introduced for optimizing alignemtn) and you're there.

[Iris Cristata]

Thanks, maybe I have interpreted consensus wrong, but what I want is, if at certain bp the reads are different from the reference, I want the reads bp, instead of the reference.

I ran a simple test assembly using Mosaik 1.0.1388, and the ace file looks like:

AS 1 3

CO test 50 3 1 U
AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG

BQ ......

AF .MosaikReference U 1
AF read2 U 1
AF read1 U 2
BS 1 50 .MosaikReference

RD .MosaikReference 50 0 0
AATCAAATGAATTTCGTTCTGT[COLOR="Red"]T[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG

RD read2 49 0 0
AATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTT

RD read1 49 0 0
ATCAAATGAATTTCGTTCTGT[COLOR="Red"]G[/COLOR]CTGGTGGAGCAATTATGGTCAGTCTTG

In this run, the consensus is identical to the reference at the red bp, i.e. T, but I wanted it to be G, like in the reads.

[sklages]

There is no simple way to get the consensus from an ACE file, simply because it's not in there.
The CO tags represent the COntig sequences, what is usually the reference sequence in
mapping approaches.