Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • rnaeye
    replied
    Of course it's possible. You can use "bedtools."

    Leave a comment:


  • extracting complete sequence for every transcript from a bam file

    hi,

    I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like
    Code:
    >ref_tr1
    aggtcgtttagtcgatatcgtga
    >aln_tr1
    a-gtcgtttagtcgat-tcgtga
    I would like to obtain a fasta file containing only aligned trasncripts like
    Code:
    >aln_tr1
    a-gtcgtttagtcgat-tcgtga
    >aln_tr2
    agtgtcgggctgag--gcg-cc
    How can I obtain this fast file from aligned bam file. Kindly guide me.
    Thanks in advance
    Last edited by dena.dinesh; 08-04-2015, 02:27 AM.

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 06:53 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
34 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
204 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 08:54 AM
0 responses
213 views
0 likes
Last Post seqadmin  
Working...
X