extracting complete sequence for every transcript from a bam file

dena.dinesh

Member

Join Date: Feb 2013

Posts: 58
- Share
- Tweet
#1

extracting complete sequence for every transcript from a bam file

08-04-2015, 02:16 AM

hi,

I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like

Code:

>ref_tr1 aggtcgtttagtcgatatcgtga >aln_tr1 a-gtcgtttagtcgat-tcgtga

I would like to obtain a fasta file containing only aligned trasncripts like

Code:

>aln_tr1 a-gtcgtttagtcgat-tcgtga >aln_tr2 agtgtcgggctgag--gcg-cc

How can I obtain this fast file from aligned bam file. Kindly guide me.
Thanks in advance

Last edited by dena.dinesh; 08-04-2015, 02:27 AM.
Tags: bam, rnaseq, samtools
rnaeye

Member

Join Date: May 2011

Posts: 80
- Share
- Tweet
#2

08-13-2015, 07:21 AM

Of course it's possible. You can use "bedtools."
Comment

Previous template Next

Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications

by SEQadmin2

Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

The systematic characterization of the human proteome has...
- Channel: Articles
07-20-2026, 11:48 AM
Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems

by SEQadmin2

Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...
- Channel: Articles
07-09-2026, 11:10 AM
Cancer Drug Resistance: The Lingering Barrier to Rising Survival

by SEQadmin2

Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
- Channel: Articles
07-08-2026, 05:17 AM

Topics	Statistics	Last Post
Chemotherapy Leaves Detectable DNA Signatures in Childhood Tumors by SEQadmin2 Started by SEQadmin2, Today, 11:41 AM	0 responses 9 views 0 reactions	Last Post by SEQadmin2 Today, 11:41 AM
Single-Cell Atlases Skew Toward European Ancestry, Analysis Finds by SEQadmin2 Started by SEQadmin2, 07-20-2026, 11:10 AM	0 responses 21 views 0 reactions	Last Post by SEQadmin2 07-20-2026, 11:10 AM
UC San Diego Bioengineers Map Gene Function in Human Stem Cells by SEQadmin2 Started by SEQadmin2, 07-13-2026, 10:26 AM	0 responses 35 views 0 reactions	Last Post by SEQadmin2 07-13-2026, 10:26 AM
New Analysis Splits Leukemia Into 16 Epigenomic Subgroups by SEQadmin2 Started by SEQadmin2, 07-09-2026, 10:04 AM	0 responses 45 views 0 reactions	Last Post by SEQadmin2 07-09-2026, 10:04 AM

Unconfigured Ad

extracting complete sequence for every transcript from a bam file

Comment

Latest Articles

ad_right_rmr

News