extracting complete sequence for every transcript from a bam file

[dena.dinesh]

hi,

I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like

>ref_tr1
aggtcgtttagtcgatatcgtga
>aln_tr1
a-gtcgtttagtcgat-tcgtga

I would like to obtain a fasta file containing only aligned trasncripts like

>aln_tr1
a-gtcgtttagtcgat-tcgtga
>aln_tr2
agtgtcgggctgag--gcg-cc

How can I obtain this fast file from aligned bam file. Kindly guide me.
Thanks in advance

[rnaeye]

Of course it's possible. You can use "bedtools."