Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Create perl program

    Hi,

    I have two sequence file.I want only the mathching sequences which is present on both files and save that output in third file...Can you please help me for creating perl program for this.??

    FILE1:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig2
    GACTTGAAGATGCTGGTCTTTCTTTCACTGGCAAAGATGAAAGTGGTCATCGCATGGAGATTGTTGAGCTGCCGAGTCATCCTTACTTCATCGGAGTTCAATTTCATCCAGAATTTAAATCAAGGCCAGGAACCCCTTCAGCCCTGTTT

    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    >Contig5
    CCCCCCCTTATTTGTCGTTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    FILE2:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig3

    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    >Contig6
    GCATTTATTGCAATGTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAGCCAGAGCTTTGTAGATGAGAGGCATGGTACAATGCGTCTTG

    EXPECTED OUTPUT:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

  • #2
    cross-posted : https://www.biostars.org/p/160027/

    Comment


    • #3
      @vineetha: Are you looking to actually match the sequences or you just want to find matching headers? If a header matches then is the sequence always identical in both files?

      Comment


      • #4
        @vineetha: Can awk be used to do this? A one-liner like below will work.

        Code:
        awk 'NR==FNR{a[$0];next}$0 in a{print $0}' file1.txt file2.txt
        >Contig1
        TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC
        
        >Contig3
        CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG
        
        >Contig4
        GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG
        The perl equivalent would be something like:

        Code:
        perl -ne 'print if ($seen{$_} .= @ARGV) =~ /10$/'  file1.txt file2.txt
        >Contig1
        TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC
        
        >Contig3
        CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG
        >Contig4
        GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG
        Last edited by cmccabe; 10-01-2015, 12:59 PM. Reason: added perl

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM
        • seqadmin
          Strategies for Sequencing Challenging Samples
          by seqadmin


          Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
          03-22-2024, 06:39 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        19 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        22 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        17 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-04-2024, 09:00 AM
        0 responses
        49 views
        0 likes
        Last Post seqadmin  
        Working...
        X