Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Create perl program

    Hi,

    I have two sequence file.I want only the mathching sequences which is present on both files and save that output in third file...Can you please help me for creating perl program for this.??

    FILE1:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig2
    GACTTGAAGATGCTGGTCTTTCTTTCACTGGCAAAGATGAAAGTGGTCATCGCATGGAGATTGTTGAGCTGCCGAGTCATCCTTACTTCATCGGAGTTCAATTTCATCCAGAATTTAAATCAAGGCCAGGAACCCCTTCAGCCCTGTTT

    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    >Contig5
    CCCCCCCTTATTTGTCGTTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    FILE2:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig3

    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

    >Contig6
    GCATTTATTGCAATGTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAGCCAGAGCTTTGTAGATGAGAGGCATGGTACAATGCGTCTTG

    EXPECTED OUTPUT:

    >Contig1
    TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC

    >Contig3
    CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG

    >Contig4
    GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG

  • #2
    cross-posted : https://www.biostars.org/p/160027/

    Comment


    • #3
      @vineetha: Are you looking to actually match the sequences or you just want to find matching headers? If a header matches then is the sequence always identical in both files?

      Comment


      • #4
        @vineetha: Can awk be used to do this? A one-liner like below will work.

        Code:
        awk 'NR==FNR{a[$0];next}$0 in a{print $0}' file1.txt file2.txt
        >Contig1
        TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC
        
        >Contig3
        CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG
        
        >Contig4
        GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG
        The perl equivalent would be something like:

        Code:
        perl -ne 'print if ($seen{$_} .= @ARGV) =~ /10$/'  file1.txt file2.txt
        >Contig1
        TTCAAAAACTCATATGGGTGGTACAATGCGTCTTGGATCTAGGAGAACATATTTTCAAGTTGCAGATTGTAAATCTGCAAAATTATATGGTAACCAGAGCTTTGTAGATGAGAGGCATCGACACAGATATGAGGTGAACCCCGACATGGTGCAGC
        
        >Contig3
        CTAGGACTTATAGCCGCAGCAACTGGGCAACTTGAAACTCTCTTGAAGAAGGGTGTTCCCAAAACATGGGGGTTGAGCAATGGTACGTCAGGACTAAAATCACATCGATATGTAAATGGGACAAAACTGTTTAATGGATCATTAGATG
        >Contig4
        GCATTTATTGCAATGGGAATGGTATACATGTTTAAAGGAAACAGTAACATATGTTGTGGGCGCTTGGCCCCGGATTTTTGATAATCAAATTTTGCTACTGCATTTTTTTTAAAG
        Last edited by cmccabe; 10-01-2015, 12:59 PM. Reason: added perl

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM
        • seqadmin
          Recent Advances in Sequencing Analysis Tools
          by seqadmin


          The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
          05-06-2024, 07:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 05-24-2024, 07:15 AM
        0 responses
        15 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-23-2024, 10:28 AM
        0 responses
        17 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-23-2024, 07:35 AM
        0 responses
        21 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-22-2024, 02:06 PM
        0 responses
        10 views
        0 likes
        Last Post seqadmin  
        Working...
        X