BWA sampe multiple hits question

[sahar]

Using sampe n=10 and N=0, I get the following results.

seq#0 83 gi|150002608|ref|NC_009614.1| 834297 37 75M = 834220 -152 GTATAACATAAGTGCTTCCATTGGCAAATGTCAAAGTCGTTTTCCAGTTTTCCGCATCCACATCTACACTTTGGA * XT:A:U NM:i:0 SM:i:17 AM:i:17 X0:i:1 X1:i:4 XM:i:0 XO:i:0 XG:i:0 MD:Z:75 XA:Z:gi|150002608|ref|NC_009614.1|,-834297,75M,5;gi|150002608|ref|NC_009614.1|,-834298,1S74M,5;gi|150002608|ref|NC_009614.1|,-834299,2S72M4D1M,5;gi|150002608|ref|NC_009614.1|,-834297,75M,7;

seq#0 163 gi|150002608|ref|NC_009614.1| 834220 37 75M = 834297 152 GGCCGATAATGGATTGCAACCGGAAGGATTGACTGTAGAACTCAATATCAAGTTGTCAATCGAAGTACCTAAGGT * XT:A:U NM:i:0 SM:i:20 AM:i:17 X0:i:1 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:75 XA:Z:gi|150002608|ref|NC_009614.1|,+834220,74M1S,4;gi|150002608|ref|NC_009614.1|,+834220,75M,5;

I have 2 questions -


The results returned are all in the same location, is this to be expected? Is there a way to suppress hits from the same locus?

How should I interpret the paired end hits? We have 4 hits for /1 and 2 for /2. In this case it is to the same locus but what if the loci are different. How do I relate the /1 and /2 paired end hits if the number of hits returned are not the same ?

Appreciate any help!
Thanks,
Sahar